ExifMM* `(12 <i0hEPSONXP-610 Series-'-'Adobe Photoshop CS4 Windows2018:12:12 11:38:21Apple Mac OS X0221(HHJFIFHH Adobe_CMAdobed            V"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?'XLxN>3}ʳKu Z PARI@MRQWDkc<((,RL wTH:QVzXIHS7M;'0)1nR۾"&c?Q)u&dŷ'OwL$" N({IGu|K_) $4NDvVz94@JVSA1 k) E 9oFw''R>e8V vK{@t - Wl$4ִ h0>Fڪ 9Wg}.v#7fb\Ǵ#_ bxuK{#MY6 :KlvX/uORƖ۽~rkQ~'V}Uu ara~g1Q{jkOH'PK民 %\BCDGkiVJq-а[:Wʩ\ Xe.Ze>f\YWĺaZgD ,\'ڏz-V g2'm ۹cǵYXj`MՒ>~ҭ0㗛j@;G_& bN,X4#pw\&tDnی &:~GQ$?[Xn0^Ho{GrUw @~%T/sDHc];{߷ԂA8x:mVnmWUd55k+[ԸzO?Y3IǪU #`<4$gC0MxDm-$V6CuncmH{\/ 5 ѾϥZlbW_Z81ϲ>TwOnM-+Ey7Qe[e^ߢ+m g=&kǩQд{]_Ռ,Ȗ.káqo/2;__LXܜOO1C_4{+c,ߧ{~ѧ5 cN?3}uuDCjoM6{^ݖSp}5>C=+Y?Ew)?1vEtvf;?vN)u`ŖxŎF2[ƐHn-p'_,uj}2_c_e[f&s赺m[6ؓ=ܷr?/?49*oޛqUޛȑ\\ i"?<?"'Doِ"P@{k efj݌Eg7k`hmەִtgf1a 1IC7s,fs9\6+Rv34[E-1^VQeٵFvڞy/1KPѮW+?SSпzYI qk ['^ذ,s0m̪p}4m`h+ݭIemEvגms]5~{=OgVY\5q!CkƼiŻooeLvJNʽo=OK+ӒэYqƛHp]}S3'8_o,OýHݱO?z4JXm:1|{kw ^~ msNlW, m|Ljg9v[ }ǮOsG={;恴"bDP^{S56@--cȩOtt'`sk g@r|a!$nS0ė?uE.'K}/w ՛ ! e&c挋o% ?ObJeb^ .kOҽEٶ٘rv!w WA>cy ][lxlOt 'Cc_莠Dٰnĕ&9gH2v>Lʓws De@ޔ h HNg6r< [CgEL Il|ds)KDM DxAIKUc걶װ5ÐGpSTM\Tgt6dMG疂};rF{X8CÄiY494ti%2kF} H<8WY:[ %ޞϴzlnm~}O_o SQ.:Oo쨺Hc@CaGhi Ӽi?%#K]':wtE!=(ckIi#!]@~P$"W )vH7F |Z{Xv~gY;5eOǻ {*k $oXlenU?*6UMbJwic"6HMW]VXi8q 7v{a+ ;gXZ~cl)e{]5Qw\{}ss~9_Photoshop 3.08BIM7Z%GZ%GZ%GZ%GZ%GZ%G8BIM%2u R[۶8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMnullbaseNameTEXT BenutzerboundsObjcRct1Top longLeftlongBtomlongRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIMi8BIM VJFIFHH Adobe_CMAdobed            V"?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?'XLxN>3}ʳKu Z PARI@MRQWDkc<((,RL wTH:QVzXIHS7M;'0)1nR۾"&c?Q)u&dŷ'OwL$" N({IGu|K_) $4NDvVz94@JVSA1 k) E 9oFw''R>e8V vK{@t - Wl$4ִ h0>Fڪ 9Wg}.v#7fb\Ǵ#_ bxuK{#MY6 :KlvX/uORƖ۽~rkQ~'V}Uu ara~g1Q{jkOH'PK民 %\BCDGkiVJq-а[:Wʩ\ Xe.Ze>f\YWĺaZgD ,\'ڏz-V g2'm ۹cǵYXj`MՒ>~ҭ0㗛j@;G_& bN,X4#pw\&tDnی &:~GQ$?[Xn0^Ho{GrUw @~%T/sDHc];{߷ԂA8x:mVnmWUd55k+[ԸzO?Y3IǪU #`<4$gC0MxDm-$V6CuncmH{\/ 5 ѾϥZlbW_Z81ϲ>TwOnM-+Ey7Qe[e^ߢ+m g=&kǩQд{]_Ռ,Ȗ.káqo/2;__LXܜOO1C_4{+c,ߧ{~ѧ5 cN?3}uuDCjoM6{^ݖSp}5>C=+Y?Ew)?1vEtvf;?vN)u`ŖxŎF2[ƐHn-p'_,uj}2_c_e[f&s赺m[6ؓ=ܷr?/?49*oޛqUޛȑ\\ i"?<?"'Doِ"P@{k efj݌Eg7k`hmەִtgf1a 1IC7s,fs9\6+Rv34[E-1^VQeٵFvڞy/1KPѮW+?SSпzYI qk ['^ذ,s0m̪p}4m`h+ݭIemEvגms]5~{=OgVY\5q!CkƼiŻooeLvJNʽo=OK+ӒэYqƛHp]}S3'8_o,OýHݱO?z4JXm:1|{kw ^~ msNlW, m|Ljg9v[ }ǮOsG={;恴"bDP^{S56@--cȩOtt'`sk g@r|a!$nS0ė?uE.'K}/w ՛ ! e&c挋o% ?ObJeb^ .kOҽEٶ٘rv!w WA>cy ][lxlOt 'Cc_莠Dٰnĕ&9gH2v>Lʓws De@ޔ h HNg6r< [CgEL Il|ds)KDM DxAIKUc걶װ5ÐGpSTM\Tgt6dMG疂};rF{X8CÄiY494ti%2kF} H<8WY:[ %ޞϴzlnm~}O_o SQ.:Oo쨺Hc@CaGhi Ӽi?%#K]':wtE!=(ckIi#!]@~P$"W )vH7F |Z{Xv~gY;5eOǻ {*k $oXlenU?*6UMbJwic"6HMW]VXi8q 7v{a+ ;gXZ~cl)e{]5Qw\{}ss~9_8BIM!UAdobe PhotoshopAdobe Photoshop CS48BIMmopt<TargetSettings MttCObjc NativeQuadBl longGrn longRd longOptmboolQltylong< blurAmountdoubembedICCProfilebool fileFormatenum FileFormatJPEG noMatteColorbool progressivebool zonedQualityObjc ZonedInfo channelIDlong emphasizeTextboolemphasizeVectorsboolfloorlong8BIM-msetnullVersionlong8BIMms4w8BIMhttp://ns.adobe.com/xap/1.0/ 1E38305DBB16242D360216FD49ECC74D 66A4E8561C89E729CC01986C05062D86 D95F2FA04EE4FA21B2B534A39DA7424F E8BA5A5B459AFE8C666B44754F3B4708 adobe:docid:photoshop:4595dec9-779b-117b-805f-f3305620dee1 adobe:docid:photoshop:4f740690-78ba-117b-ba78-9ca4ade6a22d adobe:docid:photoshop:6cb18590-72d0-117b-ab53-f6139618ba38 xmp.did:098011740720681195FEC175E423E7B8 8 8 8 8 ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$~:bh[s,>}҇V.[Q᥊dhPy&H\or҄1R$gY6ݯWjW "2{ַs] Oq[fH{tJru($[OM"R:&$S,h_ӏnFHɋGpI9p4|L>5{fO#ݎ63! )"<{Mcq+Gz5lmab"_G}QܴM`5r.GqGfW: ~.T?>zo1TVV21Yr/NCִ| :26ٯFGAznFKPO+ }4WK+HO~}O^啦mmǡ' R J K~}ȂI@$zIthJv닊1z1 fB(~x-[FP8oag 2Ec}H]{1_P3^W|uM >_~2-ovf"c=u߮?o{X[#~׺{^kS}Cӈֽ5V2,+t j'>q}zsBYQqo}Ou?ԏXO}c{aA'Ex:)0AKW,yi Hغ=\nsB!sezlmL~~wwbd$~-~ -={s\Yf<߽p]v >{+z$j~or49nmц6mDgw;"GAw&z% ,ŏ'}QNOB "A (@U O=`ǪFS$]HC}k~D@manb>Z2)Oq33sNj{=zBXJhV5]D>ybxEthGJm%'[s|N kI}7&OW!s$n()26-5u2n'VV9XgP?Yf~=8cH[}O{Of:Sbo?ntw mqߪ:ϯI,=lxuYW {Z<w3׈#\X _Ǿՙa$xhWU6MUjQWoweO~k]ғ63#Og #l)H#à!VON&hV9m6!?}սzvFYV6jK~]-o {+giJ oz!Snwz!EMf'7{3B(}ɬ}(\yt:*2Ȅ{v90WO?O_x۔>3stˢgE ECPV4Aqmn }}I)[P|a0qm:SkL@?^Q96{%.]&{Ɲ`gJ,Ɗz⩪N'fd+/]k8_H }hNz@ҕ%z)S52$HkGÖ\_a@:f:w- ^ҋ~OsYE?~U'22ԵD2 .yfu]"-PHk6>4K1oϴCCã=F.7[[`X?(cb:![ѭDi ?"r܋a4PZl"T½[;g$hIp΋>4 ~?~܆M.ږo^pؔ'Ө(WR<s}>b`4f^$u~ol̚dyo,>,,ڔ^ꠃq!MJH?OtM:50m9=g+6JJZ{!SPSc{oFc-k >Y۸ʼnci) %А?}{t45Dean-ȵ<{ZR'?O϶%v:8q1ŧW5l``d=f?Ȑ\=C=Jez*<8ɀ1Xoyi"{~,HS2L0j毦|A$ sAЄO|T׿ԁ~WE=CԵ$E '+X߫֘ijuʆoȽ{Ug~߫שS;`s?$2ݹ_Ez{*hC0 eem_[+ǧcp5v5u׏$eP8[OS n"iouN͌.=͂x'uϟWMAf0:zobI:XsFUz'OA__}x؞y$Jxn//Ae:)xqΓtՁ O~{%[Ou VL <G? _I?ǿ@ZC#j=H (^兩e?Gp}Q8=r@sD>Yec͸P)҉.8t-fM_{~/?6?QU=*f*h?#['{mqҘPJs-Qbtf =^ѣ7(s׺n9ꎽ׽^Gzn: .TxxKte+Q:sձD.<\\D V4 Xӟlo}>ytl^1*%@N$F[}oϵ+ChfWJRX-7Κ׺G@ہA}9z1Cu+ښBBՀ6{ܹ'{^Fӈ"_k=ݺSߺ^~{m~V`h:$¥Q6}/ǾZX[P7#{G[* u%MG~J*|V̔.֐oJ.?^(HEavGH`(*z{1ˌ2GR%#,P 7nG'oe#=oe4MC?zPMGRiAW[sk}5ROH'+yC&C&_}}c#$m:SƱ -{X{}k׽ߺ^~{߽u~׽ߺ]E'>ڣ Z@??}-p92+Yſָ7X[{M~{߽u|n@~aot ӥ6¿ےAI=U.P4M@jS]CnI-ܓIRJ gV??@?עޅ2DI!*l@Px祑H-pzDf6f:UI%TP[ycq:/sUѡ2ӠMaKx ߶ $w%}:1I*}sHT)\?F@~ycÏV1+NRf]Wx۪u=H`M=Moz";tבd|^e_m@7_yҒߓeG=-$ 8-w8yrRRHi#(%aL&" Z~'o-.֫{&rKTOOZ$$&PÃ{c&ʛ/d|_sp|?,h=g_dIZg$2*tihŘ_i|)^6 7H|oqƔOoM},lѯH}iN%̤dQ@#O~?=F[ǺPjzS-zK7U>ZD$SдwԤ]OV% a4iҧqt׍9]Q[GGQt-fQIy\vChouW":}ۍ#(y٫gK7! #^ˍuGӤ:p$R}^B.T9nXF9?C>˷)tzr<&F#עKuLnN *Ǖ-)"8Q#3bU-Q[zBp'rg`i^a[11n}p="ee4njZE۝5*V#Y<.ǡݷ,adۛnظK9e%}A?bP=?w(c='v6%ɔSNѷ},Z5ΎetEcBM&Dw]z|jìV`^ZH7#ův;ҝ9In;#3E7$$*̆0U%JJU<ߓn}Wv%$g'۴14Y?K<{b>y~2Az{GuԺ]ok^?@*iw3u ,m?~>=8 ycƥEB>sǥ1\(Q|Kv&jGW(Ѩ^y1ۃEWOZ0ur``j8HP 6Oj4*ƭ6lGsI%km=U{AF&x3HЉ\ ͪOx=㏧_o^I?un?5KʨGd2ێ>SP^mHfGz@ -NnD }T "ֱ#{y#,cSw}V)ZYggtπ,$`./olqu?m=,j=* `/nzGjYUNz8@* _to6)[q #9G5)YHR=ޣǥr ~OŽc9]vQITO}KGC?]#7(kRWU%3y ֖PGvT1:;A6`?ZJtm[t2g7kMTr0 8s<#<8b#g=/.p\cH3ISd!ю?^U 1`~>gһAcѯ8zi#$Ac_̫ȺH&/툵qіQ|<utyLmVaqh )ڿB}8PuP`u3V. UHJT@So JWH!vP݀nLR&2%LrI0LmoBHԟW.CrSM[W2 ["O"<te,v)=1B&S̤/ M&?^HjZwyVČxu;mJ(x]4ۤ5兏eXz~ބ,y?Dϱ>1f3zӉ0W7f$ڇ ۟Ofp+Or\]ԻbMqTg7bB?o7IB< -5\.ՠDk_{}޽sk?_]½=kvӤٔ[jS2DPY/ȿx l-q@U$#_Jm1vAE ')eP 盟OݺN:Pi$Ot:j M?Me->ԧNV6aH$[#mt!@?GdǺ=\"CtX®O?QbPǿ^I mu#'To#Y.n/8t0 ͂z" O0WeR5_[(܆Ye@omryj`S̾,5WؼTTBa nk#zu/cϴOuiVGKkjHf[1`mqk@A@:*ܖ#h)e7ckq?y>{S^)J//3ݒxj^>,n<:.w.uj*8X"+o[^zR>lֽ<MC R֊y,o?ߢ Pַӟխ&PpSK&NGԒ8TZC59ڈE$;rFsY׹-ؒOMc2Ho':%s^UKrH$so}^땭/)4R~>#6H 10MҙBʷǦu:ںRPU=4qo&k_jzj r}}\#4@Pԍ"2HUܿ%ff׮GU5$lA6{>GX[ PtyAirX:m}Ta^M\{:%@[ͤ|GVsn}K-L0KvPs}H`oo6W#: sѬ5IQeҦЎ>~=xtWз`8Qaս厘EhzW.uS,6r\JҘ#hKtS wFYו:#^}9{$`M=<&eMϦ:=FB:b]9=(8+1+kv)[I5 C)kX}4QH]ܤt;JEU]:*5\s_ځ^=RYD3Nհ4EX]HH<.?[)âB6yVlH'mNfPH2M:r5 7M9i=F8ˑayxQiӟA_N B˞z|v uVfdZvhCG[Ji*"|snNXs[ncSM4!,6k~+.3~}=x̍b3(^>16խƕJ I45} eOǽ=<Jֽ1H*U4qZC;7oMݛu@ͩu:i4aozj/Rie$O#xMu3,sGV̥n~qg:D Û}~>ȧA$ѡmL#/ip'Gdf%l\} {uU@?؏ewV*} bIǢY^Vz@܆BlK~_j:"'GEak.^NM] Setߞ5j<߸YSS԰ahч+ n1Vq ߟlIjڼ:X/xt6r<&Iosa[jfN:/ڼvf. E$4q#G 7 >aon"wEӫ*j:QOBUȺ}_oއMsH$UH?C׻=s 0 'qch:OjEϏС5}p&xzmZY}_jJoa~?Ҽz9G :[HN|G u$2ln2,d&.l?$}^cu0@7߂8S}꾝_qu6Fbrxk[ssïx!U0<=.=P4ah{~Ϲ2$^cLTn= زS&@ċ 4E$~,msy8m.ڸQs{|FMrp.[eW6 )#3܎:!}k-3t{ki1tҬUK*ˤ=0I4o[}5_T2ԴE'->$dA>ڨ˅/"8|XNS7d~k\_ {|p蟡nm@=u}p{o>]; h7M9_An5APE*Je,豢jR/ptPd`ɬ,H7}HWжu߿{^S_ޚ?*Ectm. 53+ lz ucqRG2 ȽGy,,TpU!:'כlJAIJfW$#-$rK̂9]G@7QB1zͥ|f$[In5c^{:[ӧ-MB=5g"TׯTSWr In[-JPOFINrKsa{E\?]QKm^zCn9p8&/W$pM32`u#muN5NYTPjo}eOj+sB>`??o}[}9}>sCXfIU~,-=Bӌr(r?~ֺﰀߟt8NjJWjzJ[IMt쪾TPX lϽY Z J]~>5?K A=@=/tc6|@(OIA7sgVbT-DN,ja܈!YK^{=-KUC6ׂhA&R1#x#p}~Q}|=3qM#-Z%\y h=_<{z{Fs)2s҄aPt^˂Fߴ qvM:;+i܋U-LHOMn-e})trKLW_D)i.e%_ #ځ诡oycǮzV`[g\~֢?ǟ'd~B?ߊH5:4һW[_f6 Ƕgv24ndC vl=W1M#b.N7rj!1ɿ[_xLte : /Qo )8E#JZ{.-Uq8 yYxq۝LY,`}8ӏhG-2:eV,J Ǽql7lJ^Nuw±9<RΕqON׫6ۛz}C x?rIV ǺCS 4:.p[}I+G3jK܆{Un}?}HJDn3]Xt2-],#HգP. eu2@O'Oظ\ymF.'K7Hi%9%I#f6혡Qқm [imxث H$CGoyQtE9f٘Y`HK{X^<%jq9'.1:YKEc|RmPַuX10dDtȵŭ}̎}Im-\Fpo3BEEi7znnH*IebŘCϷXGSeژNКrK%TTMTZi)=S}:EH>~d+'iu{l'ه[@z6UA<*!>M)o_tqf{fé=mo[6$]-lxצ]FC7yܔ.WRPt-3àqmecg1G9­u_ŗZ`8'sBPGQ,J)NcbWܛ~zDdV-ny }k<؏mez$lL3E4ڟ9"P]Q6ݦxDƲQ$ dx$<)dK_TO=Moa&]zhLe28?Oi`OG6wkk-8/~zUM,.=`́lq m+5$lo=o4OB1⊾YH 1=8ǵZ]sTB㎍|%l1rUo/jdfm`T'؛ [jOA;eRcAT4 3 [K^k+'+sKr7ALנtwmdNAeN _¶@{9#ӪnHH*:p^u։/~ _X舱"QT=BtPx7 ~kהs׫&Sǃ~#ݪ: RI#-H[ϾFV)Ǐſ{~MZK_x6p?}ۦz{z@}uքp=CQ ,l2WG?{n)tZi:\Zmɽݦ= , h:fWӾ{(qSU*D.Ow^~}" qOe '}oeUQʍA?}Zq*Q{/7 vR"ek:pIh) H϶*Hѐ {;>=7eY$QG񸼆 YZED_W0~8>:*^UСcM5som*NXz@v43`k#35,+ tP<X!zCˋw窱ڛ'x:'#F Y\F??}E$nlu'GioGP(2Iy:7CXsMI=,\tQȋE$$1%@k8o홦0=+p \IUHdT |fr>*(bt2: 鏫;5ݢtmǶB }hib dLe6},.8펕`9?C Г T=OStnl;Ƿc ,MK'c)P(:< 1Evޘ*rD@_>nI7m{gNsճSx"0J?D u]D6` 9pI&2C) cKA6>cIc>Cr; jXVo\_˼%c#] 0Rt] U3" %-El &AY$<$5&>I?_=DWkր'£PKkIM}oP`FqN6_RPl*.$OZBik{$#>]U7{1.cc3I($W@ok{C3#܎2cr)ii`p#!* "8vs^EjF:Me3X'$V0RǞM%n9WLE<{K'?}4z2m AWlo]IdX&\soo4s`8?#MƵBc8t@`ᖒgsC`Ym?챺piid,ž6?gjcUi&vBM_ؖGөE㹾dcëߎ]<17iQAvP{͍,Xp?_іҾ^X<6fEMv:ITbcd-seB},H@:X:H&W+ʭ刑ca\msIJa~nm2ŨqA>gؙwNl5,MH ^4= AoaN1Yi.#1 '%It:M'ߚ;^?ZSӭ>~׬xߏJ RU3) } l1ycqe!)y~Pv>]e0j]Gҕde͠{-}[fdPRI 6ϣgg7.3QGMq\*w?eQq9Z>rmع8䶶}7>W\?KvqxQSI.Ρ3 Pea3DNM xNܸɭtj><Bww5'XRL%*mMk5퐨6ϽC Ki]@ˤZ-4zd.{M?ےډۓD&]'[}XT]);/ 㡱F#TXEm {Ol+tfZA):'*wK8Q>EB>Ri2e{kkan~ )c;8M9$ }`E Iܵcވƒ2:)M/0OF?(=1si`Ap7S zxYͷ:,[sT k>*I7z^w/avUnBA1 H7?Q*FDRm+?׷7ǽ)m^5eLF؅U┦Z WˡF񘅱z'ӊG64!o[}BOڛy|TFf,<:[MoDpCr~/2`ޏD ˦3R {M<tk^ю?]@WU/q?yǺ ~>ۊ)q\cH~!wUAD,{\=Ž uIj(+i@t9e7F]TWD!uC z o/kcǰI |:,Snq9Y4I^ki nj?#JG}_oŽFA߶b'CrY.cZbTZޫ-ccktG9]xەo_|m+ ̪*q$*zkg1;rL^*:XGi\["܍\X=!c=,菅iԅkiP*U+{7ٝ&rOSK3Em+~9Tlw?DÌף?_qTfU9Xr$ {m`}_ـAyei[qZ43 YTX}E{9QjKZwv*k}=g.n}E:Q>/.LYKsn߾O~tHPY}I }}ߪ:qJQ#~]du|5ߋ秢Zyt˔-F@VǏaæNI9>5O}k^oׁpI~0U(ȨX~+ìTmrXuQ%:_7I+>KP}]ʥYotnNo|zONl/kRcXD"0҂A{d0,nmvIiB"g.W(vK' }ɌBIQn>6ܦTR?}3h95–L-^hWpLd:ݪaozƨ07[؀,=ৈG!{-#+8Dxˡ ed㖡*aoP&s#ѵRXp:UQ#ؒu-}~QkomGOL IQ.O=1TI{ jvh$y& u^Nuzt};tmxX"C Fox N<tfz3x-j[о01*8< ]iۃon7/ z.Ƿ49] x矠 a t"'h=>]íI/Q {`somkoJ:gSnqQRaTAݭ>:Ia$O~[j]͔ L.@>f drH5S &j)XX3}I_}au<[ߨzFRWӬqTC(ڗZ ~oڽzLLWFE?X{݁M6F)M<].RcIfJtLRxTv?xnSÝߵhW3,ZG[H|khRfAظb= gZ^ ilmb,=o~+os~hЇٸ59l_:{w1A]OW!)>k=Gs."=m5t/AKuvawfw $GDfxh\ytW7;!fgI,.~p=K$t&@=rcJt5ڭ44긶^[1 ,u3 853.?{t]+t LW&m:kK&oJ-ݕyz(– n+&:3ia2!:ٔ܋ ]"ڭoAџFԊ/X<:$mmk?߉f/00I4GU_Mxc^-5xn:iU5x\\r}?ä].PXX=<>f#smH1ڛ:BΠCr]xsyd.m)7=W$6vm⧥-S_}$Xy24= ,$n_o}9o|Cߺ^#ؑzij4DN Q ΐmo6ȑuz2kOAd=hSK>`,܀{KAkߛ=Y<4,3Nڋ?=Mkl1gEcib@{[ FEcɷʺ:u@#5қ70e餧e >`x _{UGC?{{AF6^|֡x+0]7_ՏU^@UuꚊd["nDp#~=i$rP/,m2lnlmU)uiaq}#-Ƕji}]s}E m{O~6z:MUQ-K$6=]x Det?`dU3]"Xqki) h[ͽk8!!vb֗EPv+foݍH*i`dR?pC^jDf66B>&mW\))V?kks ^UWK6&}Мa۵zf T"b, /Ͼ ouzXFx$cÎo͏`8##~rz*SuỦ~|E>MzNlrGӟ҉BֽmohehЃhY yTQ4b,#:ussqڇ??o1 q=W 3];գ!fbuXC} E} >=ʨFNzO]]|V O:IPDqzܬʕL6܉ A?hnv: 4THXEf}"j'@-Ǥw3#.z,<5t܏oTƢcmv?Odc~ö¢* u^*s*OP߸i^J,m`DNUi-7{[`-xI3 .ݹUsW,3P8<^JQoku<7>]6'd%#y3Cѵ%kaN-ݘ=UT)mu>$>*i Ō#MAOOy?FJ6օm$ҏ܈#HJɋ`ȪG?K_Cdžxy1f&ܖ 51x"}7{<(MS< 1Z89.ݺq涊]M(6V-u @_oH5zy57'=̡Xrx]NbOk5X *-FOoU᪄]GކQ"&hUwr䚦M ]OԹV=-n?QOCH!#yq=qq7HZܒ?ڂ~d>\Q3AN'k3ҰgVV@w7V)Y(4@"1ݰtn,L+ɹ7xCR}Ǥ1ҊgOTn>auu>z1RU&9"Bɠi+^fVdvʕ-SlM׶cQ%> :y3xت>GJ>= _w?Jܨ+zO?}ѥ5p쎗۽¦ J2Qf~??^: +>*'=.-ZV u :. QǶT+-o(#DG*,%]Ef>s0ori+_J,czH~Te1M Z̀o@'ۑO/rPl23#Κڃ{ {1h +Nڌ àCuu^44E,EOUOϲޣ=C s[8P%Eo*+6K^>2U p# aO'H8z s~ X xu`/EgTL31̭F=_q4VBڹ G`ˢ]Ȭe_{D9<B1$oHܰ]J$X_۸֢- !'1)sN8龧 %&Pub5?O|@ ?~=c'&Խ5a@KU?4/~I|5>}*'Td1WP-̺m>WHS16fRy~ԁo68b?’=ʒ$XՕ?Q?+zAaٚEU+GGZ)O >ä=/=Τ6b 31^v Pvx 8i$:*/oeۑ_ۑ32 c=&c9φqҫyLP43}\8nG5x_z/J+Ln??OJ^Ut5Tvz$gDo_:x[xV}[1К-:[۳Q*Wj <ΌcOlOdxt(ԋnGTmSCэT}\"+$5=VW\W^`뽅M&'g@܏( ~?S'=+kbB:Df{OY61jZ"]nlEI4qmY[t`S tؔ%KguL1&>Ir̜nGǵ O4 # Kk )`IKyGK,(uE<?<{k3?=:FŒGKz9 a6cW?:U_ٕ)#}4Ѽ;3![zr{ v[oۀJw#ŠT25՗+XH_Ao|u~׽$CǧZצjVBxɰ?C{M?{MU*$D['lJ̨Yrz2y<)tvfc5q9%1VtEGЋqsY7 %HCHvlj {r|켕Yc'id(q_mP+} _-ٝ 'Am!`-ŕmU)E6X9 ~?Eь{싋_~<:\]c_mkK\t^9ֈSz<҉ͮG|=xt:upTbc'>0m:NxExFUq#X=n20Yve.ҲmcqL 2A " Ϸ,wcI Aғw94QdK,}{01並}u `uI#r~Vg>MMKVlr7DM:pYOa:/J~{߽u~׽ߺ^&Gȸ{i:0XtJVRPSQ&eS%YK@X_v k^M1S dAT G,9Ǿ{鑃^uJ}φHHmǴE) #M{Xkà}||ڻ%IɄJ9Sp _p>ԨE2ҹwn,e$iTO}t?~{߹z{{uBJ\vﳯu?H{^{{zp*9j"X}G?}(w龝<_!ߺ]<_u}Wu~&{\}u}~G[<:$~0APA~w)u׺{^{{ߺ]G"~,맯O]AE_"u HÏLnZl_y ,}Mqݓ'fܔ ,ob=?ܵRߏlqN"1uOݘKe`~na{E ˰__߮&cTl̺NƏfm֋.DJ*4s{q?{1ig tUG;'wY#GT#=w'ǶmMc{8:5ud4Zҟ]xP?QzH竦_Ǧ܋P^eb}v!!ϿQzzV$'E6YYI31 7L->އ0R1^|.c@MQ׭դzwW RWbm>e5,/n,=Ck4ܤ^[zс"6'Doٸ b(j;r~,.Oۛ %MيX,gR}nn\'ńuqA M%Nȧo_fAReCѳ\LImΏN~L~T?N3zB *ir]?EuOmY4=,ޫĎ_dő]}#@'ck\#ϣشQ5'H'Ccnyu3N8_os0ybIpãK״]1νoٖ\G䀍T}?P?xjc\_[v .ۻm:ZfƤ^H7ܚj"n?=Az0asC_>6.F< ex,B@e[^,>ɩM?..f3Xʣ! @7?=nCwʄ~"_X趬KPʱ,*~=å} ?NMc(x.1 _7;^|i-~-k8S8i0ܪN$:̵tqmfNԚn3=@7}UpEuūjytgZЇAK&R$궐N:!Ppx#ճtOB~=NFjy `Q {$Ira|1z}gcN[E3D{lDaN.ͫinɥ[ h$~/,+ZĈ(WW\j@wV8))_Rƺ')7ϻOHץ,дW# {$?Aߞ=)ZWO4mM$}yPZX>_{NIJ@[=$~G^J/\}Gv_z<:4=b!UK xc}_OKt6*FXqC7>[Mun Ѵq@g>*aKKU"}xγbE{|V@Sˡx$4\i"R4*-;ӵƍ~AI>vxq ueլt9 0giZ8Wuapy[ۖ6ᅘ~?q1~#IxˎIKOfQ*j_'_ۅaM Z{AfAJy 7E{wqT÷7{ߟi# q#؂'rk`9lGixT|}32RE#M ƕA^/'hU%_CO"Mqf٘zibܮSh?Lua> 8_G8/Kcme:OANwnFZ) M oǶҦ[{Weq&itcoS ^?!GK\{S[ە]sꬍ6:Tǣ:hۓ){CӇ½&tEknoE4N!JpEzhCe"}Z7EER<` er8^-Q#=E_?^ڵCNWd(4AKzVtbkq{}،t'+ =,QLFtԪKoJt2 NkKΏXL*a%p:EcES _%%]y{m$ssxxtA=aFDUJ Ћε'/TwGG%& -4"1po;oϽfiM[/ Ma& _l@?_${J!7(*?4Monn@lMGNEטEzG$[ۺQ&[hZkҢ V8|F,{Gr-(K}G,}xVu^&λ?F9Yj9㻹J?^o)#.~/qۡF8iXizNmχnf(5D2"3)7omnàc+ՏT5!#]?yto=(V2.P@yЁǹ l@N*OK$L4FF^o>Ep:zO}:Pul4%ˡ+ cb?/BGu}Xa{^G?O?z^[>^׽׽:]_߹1U}:MҫD}[ߺ^6j I}$dl6YHD+[s 50@A ǐ$)즒Q&I4Yc= I*l9b>Oϳ >]2+v X^{ZG?ן}oujmCצ̅L^%,mcp h @xTԧs bx m _b?vល'Ǟ )oo}'O?V l9Ov9˧]h㐋 <Ï[aاz9+{[-I1TcƠ.=ž- epOkE3e"'t,mz*<B,A">ߨISOE_y#MD<_־; bFp544rRm~No"zʎjdp~_׽FU'Mz0E[smUH 766:IH5@Zha=f6ހZ8D ?P`[>׺{ q`ìO4q',n<{}G?'9~g^b,xn3)O€'Лa>OQ@8tO~RwQx(h0#c(ߞR"ſ_dŽz-8ced31#R`V+^2':?hzU/BxVIÃ6HkIt:pAیYc+ã+.:/igEbKq3 r_oͬt,CpQHO='Kҿg}qS=oxc#>}:\J!VM+=~-˅rmI-JTC%ʹ~?[9zR"EQU [߽v}B?y4:uɩdQDH,zEe8haZ=䪕Y->MȒ5|J՛=u@s{3{ȪhM:fIWU1L."IT; \O&=Gӷj_OPp8mMo}oto76ۧEM:i<qE=Zt1]4Qci7Hﯿ}(xv&sVw+!7(װ?kONGek~J4,^.Ɵ?{F}W$0=Jbex/#G+oCHh:(XJ,ޞ/G^K71Ȏ>I]uS4,.S,5~d!h&ܛ$΅X>ߏhc֧C71KqEU۟p5ee˧<{mH̒cB>]E0Az4Y|WW,xP8WU"m>t>H4U]ؿ*3\LST<&66}Op2DnAok$ˢMuDsћ[z$jX~klHO>AP#Gj9`5 >c+֋=ef>X5B:{jx n0+hu[Af&7ݎ6~zKrΔZ{n}xIR-Rmnx5ѣmЏRRA,r qǾHo~<:A,n6}/~׽@oǽWDiJ WWc`jْ\ta?_KW B-O(v/{% J*I&=vxfNjtMÇBƚE19c[9]G<{6ۀӢcϽ׭GGi?@H~U=d ? ޭmN <<"xfYxxux?r!&:ױ?~L"Pt[hMsT mp OAg'2`Ě@7K[^#ˢп.^{]d~{J m z4Bh2JnWIQbAe$n#]kXL*=jIrUR )RTXCY"1}XkUztJ)q&zl|qmꦧU*i C_*ǥԀ8>Mc t'naÔñ&7V㚢amQ$G\<ok< \Io1q,n-GK:Uo> {}cerC˸)j)DuzKI?smmDm8J pQiBǟ|/sannOFM:YcVvm o>ho}c}gZ6$is}RNMmZƥ^\?Mя {5^X4/VZHAT}rxDK b"WeE @~=> MdnJlE53 "cl=iڍzSRR,eWO~i:H+ML3|O޽۪t8( au-.utǗmJ?FEjhA[}[^"t'iu+h5CuOդ{m@>)$ $L MR~ږ8>(hPN?w"$5 "_;$׻iTS#=8q0X"7T@$^AJu!+1P8_XܟDž$GUTg4Q^Rѡ(Iw}f ~=P&wȱx)~7VUU 5H_=S,(h:iaWa??yu֟uUGIo'Эz6xHnt߼Ee""z~Wa*q'Fqa+0/B -ǵ5=@;K 8|}nmͼH}[{{:v-fǒJZ}*!~=C {lG=(Ogn|uHT "3b?qV^لVJ&"FSi6W0Kif zOUX`KǁC^,>:1UҖeYx /C娵NKd 'z}߮ښH*lu1b/~'IwakfUqe{;7oTckbb/c:F+͇Emg=x 7Qg@t,[' JF&2^ۖR>`5 '{WGtd^\EM􏯼LN-}g ugEӏ?hi` }h <_eWqZ4C5>}W.ݻS$rScp)E I" cxaBXvS~}3lE9=>t}黚 EV:GBeK+)%}O{F%Z~ΈϦqѝ^{mWA{XG[?O uMq<Իr]Q ]?`O>=Hny\~ټb RKg. z6ŒYgb#?["n/ۺAGTP WSjj$ [ͿهVo4qVmt骳~Ql+))$HȄӨ麏>ݢHOY?i'NOЪKxXz ;sv&ܒ>פ1j$o[¤L^R]MM1*1C+? CLVߓ[U5hMOi~u>.oTp06[oxm'{H|NRA*HYmc#TrE_-n4ȭBsdۤ *zU.f:`-ې pğ#۪TY,t(zq[ eUmkTTI6oe41g'=VuEI)<Qíu$?K?=x:⮒_I}m xk}ɡ8=c% E@]cb86zFžq+Ц=@~Ί/bǺ{ѬURct m8A&.&rYQd}UT"ew'ڹs{SI^D?TC'񹷽Nׂ*}ܯMӯuylPӟ{k^*INClojt^?8 i=˽M-/}/) ȼB4v EpO>tHrkу,kas~}=筌Kͮ, &P@@Bf^*j 36q#!5S'~kn/ =g4:Nźn[1ax+[snGigGZܪҷ۟~~Ug`su,8qx#WX8cRߎ?AiO=p!ӎ;0n"sHkw6:=Fj豒0ZM_^F?G+h(S=wҚWYvץ$SGLPB"K}~rl=тeWR  ,E>)Xq˯UN;"mIMV.C 4Qݑ 6Nhj#b8ҮakpӤ7./pd34!UԤh_Zb OӟVͫA5TV=D4˪g^yLzߏҵ=+ËYSC+%q#A`HY{ݺ^~{߽u~׽5mTtܹ$E7b 4B"ֿꩡ[GtSZf+$%ik.p16qh R1ɅZJ2bmrx7r8V Rv{|]U X +{sȷQKP$\9tRu"{2:ӀdqTK1#XbKRy^A)`*6t0{֒ZO`P  HG_H^7++/ [HWf&n ]&> O)¦]r{;ʮ@sMQAK5BHӟ}\qo{"֕USGU@ @"X=i$P>u CQ҉nwqXzXR[{9@Pm7ߊ=ZAͱMW)8cɲx#O=*I5A}M2:!]$:q8()`&ī-qu7ӂ2heoX!?@Xh:~؅XL3Um,RK k@4 b~}A syqoyd" uZm\vvC1=D 8"ڬ-6 oi`H\Ѯ5尌t7_[nS2;)MH]q5O_] *x><S-`Ƿ=RkY`S=ً2c*WQ%9~'{nߏt(n9櫦yѤ+({|jxE5moT;OC,,m: n슞<> }-X j"we~Va҈m啀Pi{/qxi娪$Hّ o>ޡDITۃQ/-U+^wCZ?UnP>ڪi/?_ٌR P95Y},SG/MB5RSю} !Xs{0^'J#,(:enZ磯+v5bVQ/Fp~8AL<9uTF@rt]IHXKtAkxN|y`+ w wPҜ~y@_e] =%dmWXE n::#ev g&|I6 흥@JgxcXԛB&0GОע,o J8X{<(ny bg^5 MꍓOw8Ҏ7k='+9آ$yu_7-1z>Pm-ScQm[{I|}WHCR>Di)(ڦ9(7O?7gLxV Kf}R~'*Vk42TdB"Uy4;TVÒ~}g{3\]|HMJP j>+RY67kѪ蹒Mzi^Z<ɒzO,*eUr9HeZA{S 4k]@|];jI;x1 .Ki}?}Zߟϭ4Qus/|n+ 85ie$(d]2_7?q*נ1Gb6_M=Ussy[h7ê#f0)#'lEWJUJ7CX v#?^=BDfFo6&XՆE>/y _[}uZWN{3&tI~NlCTa /q'Nv;n4k%Eh4Ew{Ԉסa}&bI63k7mCZ'ԭe6Ԙzc\~~ZJ8;Ol61#ojׇDRd$pF7Iuysq6_1bCZcsޙ ES,/1iXi`~/6B2xѯqn8lX[2o4Dk>P^ `uq 2(+#UO)p9=NctM9J rs# ܑ{E*zi`(KB+k\_uGVm$zb[\uZT-1!ʰ:M9okXzj5阦1V}?p &V=q$`cXӂpU$}y{,?5I<߿uŸO׺=O~?Oݧ=,]@D"2 Ƴ04ͧȎFG܃\Ozеy::j ]1IXhI*Ho{}xzM3J8]`Q,>`n}Ve:G~hE:ncp(xa"΂ |/u_ej_hyD2޺ fXbRJrquwhW"gkPnj0TKh)|JH>ٖE+ҫkC}s[yHڵapogn{Qcc` ^:Wo_K;?cXcop9p\^}׿tIV%TV_Š>1YPBCo2/2~ރzZgdM6˴J_F/ƥ a(E؁oǰ5Ua_!A n jsHPj<UPx<ǵ$ 5o5xN=NܽkFK\O#ѤB4FN:79CVV s->jc%#cj#KNFBhG"؛->0ܟfd{kE懠6۲v/<%Y{&a8Z,?dw&p::[ɸ⦆ZS#F/7GԔЊWfuǠc(Qx!By8ߗ|&MgIJ6ˑh, $8O|W䛟7ެfWݯa͒a4MT4$Y?yh>FFstKN)vfk7ƕeVVm|JU'Rcp9s!ѸSnVcH֑bOo-϶ͧnVaS "HU z2KSW]EǸk?nNtkHqﲋm_>4 ]-eD ~ȷqJ?ǽ4ǧKgͷ[LUwaƭ:i?ܩZt؃sa툭R&Խ/%a-9uI1(6 {Gb yMN׷uQo_]i&a3]N6$LMo3$\ӎXD"V8?}m2{HEu*|QbʷI\P_2)-smX2`nEntiנ驶Rcf-!@\RCkʰVӼaDlM#ܯp$\ b7)D&.53<٨+9HTP7S^DPoU_H8smJ׻v9X7b?ȺoǶ̅h5X4#-zhpm,t:M>n跷nz,g*U=ئ&`}oټu"Ǡ]Qpxud9ۘ+TKBU<0m#=&&%OTT $O1Ikkw^RmS_{ ^QP鷖N<_X_M>!Ҩ.lj+v=p5P!x$[-*H[Kx} uZ0Y%# F l17dzlA BPa] W5v΂ic(K^OߎGӢRy3*M%6nHMߪqރW9<> צa#k ~ۦ:P+hGO@S^tG}mo\1#cTtH5>h@#CkK.9[sI$ s O<ZtCdEjlo NBcqq#+:^Kt+ ڔ_ϾԞ?ݩIjzOt#U@}cXN p9saҾ:ߖ]]R{KT^UC ? = @tۏqR:S XK(:H|Csk*"P,W4>dzsիxOv{H Ou-CNUjzkdH I?[_*{{mAvt<5F`51y##ߣ=Srdg:Թ \l6#_(B ?päQ^:5/U4q.uiT_?N}GpItN⒡d@*Ewco{-zFn<#%%ee&S"5ȷ&5}%ZG^KUmtPYnQBB\ K}{,&5_=z~{s=3r.{'>5HҭG nPFnߛhhГhz)}عJN<`=̔np}A;jo,kxҨq Y\VU?nWɨjyh=A '=24U_k@$H_ꙕň=ٲF𥪢)dXH:b/sN?)x͓u=W ӊ#0F(#]Tqȹ͠cQCAG_e,Io~on3K,o} :>/!9ɮ"YQUly$X}wxTuUxed c(e%WoI6< ?GFi =E-⍴Lh\L4ZGٮIդ%J:[OwCaOMjN'~V퍽O)A׏SӉ*5!tOY%:{l@Иƥ{~OJh:QqԵ!@cwc'wݭ?*3XPT7^&:7N̡‚NQ 9{2W\&\AJUFIXqˤaF|XIW*,!m6hg[ZF`M:S &7x-ltzRO6ǼL[I{`zM$min=)2P,Wp=?CgTy[%M7?ށV]u*:j;iSEP 5$X=[yMN8YRx!DAсM.U2)'XJ?@N2CY/yDf]6!n5[~->"pd,ɨ WHmKbw̲B׿UE(m\ⲑUa&= =*qO*,q[t[IAF:\7} ` uRI=f(QFē7aD?=zBȊ;???kPEaoޛWK8MI$~EF66{$*āg UFJ܁Z7h@Q =<ʩВEz!5JTy%YAcE'ElmOqc=p)ܴhV+gSdjirDj=If!kmՍOVEMIOGEK4*}͸ܟր'\hɫ~A^>}k^[߇muE:V, *Q,G{xCF$ϣI> R99qyiT1$7O?}zm%O7{q&WH"ν/qOR oo{okn^\OC:*zqU kE؁o%5OHLzפ{4=%K*BH<KXߋ[{zLP)M8ޔ]V?yd˧1tnoY*Mŀ>OJYy2)tOD1ʿє}I߀Lō[=s!1h-¨Aoǿ ӭXKƺk}.} '~xsՏcc_!HR6(G%OY44tѰĚ= d(m?o*(4LW}LY<=4Бqŏ}Ztൖ٨㠿;pۮSo"[NÒ?Cǻ-hïO|O,u X۞M߾i\ ةjD{#c#[, 7>S~qJPE98= {oe"P9$7WQ MA1k R F E#k{rХ.A=)c$<^a2t 1HScf EO.e5ϣ VLeP|6[o/|㕣m@X޽hOO;Ӥ{EMFm߿O{<:^b\Ⱥ ~}PJ:Sc"6ᕀqtuPck_xg70^Op:}%%3S$*D 3ܛ~= :)wiACM0"~=>:׺醠T#Zȵ_HGO xW˦7£!Q{f,ǽ*{e m <!f/׵?O_}#OJr"` FK ?QoR0A_ \SBӢ_2x֞XhUY>jf2H~cjEBDWM<޹[GKNG"&C?ot#%`.un'|3PHH&.-Oy唸?~Oi^O6:Fa0AVg 4$ ߟϸ0Cʊt kQ'~:RDW^_EWGX}}{^{{u$lAdV#JA{~PH6^G0@%tN&jxI)A-co zNTIW\I$R+@?>}W^{{u?>׺V^dPެS Ϳy~׺{^b${^eQv }XFWۭJ do.y!%1yp8R?7n^ߺ]?X x$A-tOI<)y#{Ӥl/"_if0+aRcA]dUyDUBbm}?~Em[B,l-zGc3C%^mk ֹ"*\׺׺{^{{u1YT Vj ;i=$6v K%L1yb~??}hDN[#ޔ=jMS9&{+t4_:dRImm½7 iӖnSWSHA-,pA#o(Nz7h*:<FX4ZO6oO#~}kNoM''5M7j"]Lݛ[>=ZYQ::kM qMfdZs%=<_f"Ej /Dw7R=X~kѭ- ,ZT)"P~}?KOvI@RE -co{dJ>ڐz]a*G(-}8ڜ&x]UsCf>i1_xXrtsf0z=Ih"gxkh} <}1N Ѻ(e9WL/߽G؞׿Se5RRFIJJd?aabX_zY'Ъ"~m.O߿յ:zT"X-C9M>??tZ]"6{bd?7V_&j2?c_>]n_WpA n2+,X؝W?OpG~=蛡 -k [[~t̪ bH_ە,:,GL0Voi!.âٻ D2U6$q&_.?۠\b= ^2`Kp~H܂V~EY=ZOnctZAAemPўE\~iYgwuRo $r4 W/ n٘}}m1)iQJ ^t }O) ѩ/koF`5Ѓj]IwnEU% )KaoxkiؓۖN'i}mjcMRϔ2SrooP$z'FĞBD;/?I\{Fq]U%.:A)cIrfY=W*V-ys z_crHj:Aocn6 @-B8@.?ǿ-@ݱ˳kD*0 Y<Op4)k$d^Q^:^ٙ/G$VO=6J}GOu笠TӬ;(!7H@f0_qtOwhzY#2C~ֺuy]lqSJ`pzE4e#QY-{"ߟr&?n.xs ۻMKfvUn婖"m%}T oֽt4ԊH7* ~m%G##@\.+,y OS+ ~'=-Lڻ% ۚ'Ql7IM:MvgJ҂3Z([nP6KR,kč)ÒS*փb^&cMn¢)r7+?zl\UmL)# rY:?C.z*6: bd"܅&X&nmaǾ>i4mLצm+kbluiN o&~Rv,Mߋ>jE-$Pq}昬/P :\($XzW-*DR$!A)[~oϷ8t^ 0n*Yʳ$ZIcT rz%`ץ> 7]4hOԯy[{s,=׽0r?{-V?o7&wg1P$G+aiOe)lVCݨq`zz/+3ֲx9~c턱bIMt g.u>F*(Rơn\} M=+߿?jhk)џ_zs^(zj s {<1O7'݈^Vîy\M6N5Rt#[I&iZOOkmzm%;-76oݺMҧDItǖ%HLiTXc^4Tڞ*h]]u<{l#gZϗ\mFo$_ےc 6bHDq0,"@*z+^#ngMf&* +))<`&-osGInvƀSϥzmUt1 {#f6}HaSRӉxjy$}VZ>uPH 0j]CQ Z4i=_Oh\ BH&OxݺE~׺q$|-[>uVzU ԰|hba]KycW <=VZ VaBE2(W*:T,U$$G%~c&NOyaGvI?׏׶؁қx䑂c%D/)e(:?ŭoJH=bj5~,t]2=yƑ*bYo>kcՔ_m zÏMx4tZ]^V9cqJnTCF rѲ:>$( )ѯj=xjbUnArRUg=6*7,P~Z~=#'m!X34tΏ9k݅7r-S:zK}1e1.@IT`. "/\צmQ,l__[>N*Ce7k|oDӚWFUBz i$ߛ {ɶ㟯?+3Ӌu}F\F@=]oKu76m>Zt%WpR@ܹtJ Ps4E:Ttit"ѩ#۹3ط|2<΄R3tX:׎}SHۉcaRINQ *' ~n}6X=MWtcP=M:3/QVWXZ^ɘAR(䭧)٭'qsk _߉MI\T(iHԋ".JW1HH<~7۴讽 >8_P޽I۟az\[/{{D؁kߺ^Zo7:'IlZ:X i"'E$G9Z֞Z  xduVe~/m#֤{/3M"h GEge^kwX ʚܹ~yڋqXUAqNɺedrE+[W@`TUJTr1=T)0I36&2\nЉE,! 7xW]V_;i8i@s-+g1Ӓ4 7`G.P=o1]n;k%e+f~@xEъ0~@>~o׺ˢw"S` kMs+CuhmL]ђUF-$ p(b28oi,f> w E݉k*EU 1v&WEPӫ172AF}Blw1<7?[cGK5蟏}XיU6Z.ޛ_{[4Q~li[8Ƕ^D[k IGAEʎ4~A {}R ?UpB{]Գg;VMР{}1f~'g!N6:*S*D@C7or&͏kҨDb:j2"*u&ky,xxgۛ\_]$t5ƺʂsѫ@<{ qI~γT@` 5(>Ik:RLsԥ5&BRH"7V=:MҜ ao:d` }/b.-oJerDJcn/}C}쎜fzXBO>sn{K Wsytqe0B.PaX MAIXκU~p}"mM>5 uM8tRUJ9bRIM!##ж>-OJnDUHյ*`Z7@F*x:)B>t.<|M$Qp"]~>Tg-Ϳ_7-h~mAruF;68J64U t7ـj$\}?=( ZrbĚl.ۦQAKLIPC'U<$.9|=8[m)/K\^V4 %Au} &?H|[M P>-x%hP}}HD:SitxGy~KXR+]z굾d6=1ѸUgMK%`=on:cHcOٶF݆)ZDӀJ趒 -O2?sB" AnN;gaUm gƶTfM ן}Ǣ1u!C%FTT[NpE$fbj#?{ 7;ZmRԳ,b-̓xm1_om*jMzeƚKtA:b TgWQLXC1.} l81ãuٖeFŤHKuG?o ee7=XD@vo{c5EZb  {NUc }o s 4׺waFW-=e[cg7\ }X}nyBJ0zMAsatNcI?(ϸrE?}cUUszӍ4Ct~c9\Vg77X\ܧHz]Q)Ɗy }=V: Z#կ5CЋj݄ " |*=Yڹ`",So|6REǿZ7NnA2Jt[smb93R*G: tpO6+,Ѵmn?OyROXR)Ҙ&2uL|K$i_|-`.>~ZukkufdP>{GxT݀?KSݛISO^̴[Jaf}-{ythU=#X戅g} _ַs{}O_vE:CkG7?>eT=8ӁP&1Y_>ߟ׏vrFTUUk{]s~׽EEz^ͦ<[z C^i٣ORcȵzJ;ߋxI҇4 ~uzv:/7X\?[u$Ae_,Rxd?:C%^2qn+w ۙeHLS\蠀yovŇ=&i$ou"馡}o(_^]V$FC^׷pD;iX~a#wxl휾uWbj8Ԡp/~E-#\:l0ZdU28djXROD7!-UKP =1ԌƹFiG~|&֖#T͔Q/N#%H.?>=O{'ݥ`=zē7yo; 6 }B*Ĩ6ntI"@{R$Pyt>b~>Fќ\}o#n?uALxZDYA{Vi;OXv R20J~ONCǬbX˔ 5{^'u|I? {^RC/-zgK =cG,:ێ?z3Җ>(:JRF*3 \)E?ۢ;A?hewlpwVn _f xi j}*Y6+oԏv*.ڿ z$mcT4l}>F&/Ki, [S/?oKbK-ҤS˥K!ޚeUxtGC}جcFTR/PƔ)αyWo}5/D7J\NX}PҬ4423%ow8bHr/޽\W^Ukn?tF{O+lÉUYN!x_׾>~t#`asP#^5'so|$)6>܈1r`:XٳݩSMtA"lKI ObR9O#ަZ)SkH puȀ<y9@kAb4ӐogY|=i G-?y\:3 ŗ_$%SG+.,^y&@yn :u]ɼOPX6(f`h:Tn z\>JW>@]"7U% X {K$n j*Bڮꄃ;J|rs"ZyXrQ/=x͓l6.XAWcޒr}P\ۀ?=i>] "ӪI4|i|BYh{ /?{8 ոݝPCǣxḣĬ8 .MopH }I(ltYoy-5еvV'r_ -4 !ck +H7+suh.å mtIj}?ZjőlZe͙Vzmw ^nCk6WLy?oojtLe?סc OGb!t>B~'۵.Qr;wBM1ҽ_)h0u$}:|ю[\ݫmaYKrfI..3NQhԑUc=W(y^~kq\ M\'M&sm$ q4A:Xc%EͿ ]pqѾd.mHOEGfT;S5-!d ҄lZ,_̊QvL@ަ5f7#L#xP?\:AD`pnzXrsK&1:.@OXAǸzZ܍C 1ێz2FbDOhJS {tԑNXx甖{PাR{O^F]`I ^C@`Oލ䣡/^67DwpAƢ>>WR-8Oߞ9]iu###=jMF|TwUWD;댪4GXyRth?yR1}Q^#HAH]>dJetV>> D,ğ7يa'эݣcgwȽ-E0xZ ,O{+?4EP%+0f_]EG*A'P`G݇M)[I= 3vJARenCS} z%OFt9FZN}R{1J #4UAďr=Is~oĵXרUDb 4X >uSGֽZE^+lMTLƺ2g8l\x ^?.vͬ])ܝ7^мQ ]D7@-2$#5-w|d{iER*]Gb9>'WorX}}"jBх o.۵;QG $^a%IYJgObO 4qn\/Tm)*y^V{ʺ&ǟ>e='Oҏya[S )QONG]E۫E[=rF'WEglR=kVDHщ`$U 0P G`(xU_-֐8/tZͰ"TRŀ scoo}.@GZ y'\I*\Xf$\78?O6K}ZXˢOpyƙ#!fX#rٻO.nٞ==ݳvK3" άT n}N>ȭlD'SK1e]3$&)F>r?{Bj<ٯ<*fivz4k=><:Aۧ@ I~?=$~] Ŝq%sN vw75~cZQ$J *o{˭t'O =!{PEQOr,ΰ :<ۏmAc,cͿ:46:Y5ɤX0ݞ/bO } |BZ#V}Z{r!pGLVʧ5@JkaMsar@ϴ" p4 Md$NlVOX?1opd:[Ln )*rU@ M# STH=v{|aЖ1ͬl=*u<{D0K E8C)t4nd.ăc*$Y(aq"XO+GzGk %Xg[k`i)rU6]jrOkm;%9ӿg$R-DXޣ7/_7>z~U\:Q~|cF{k5 zǥt_-=ҾЅsTO[Lo**eO'"^(5tY#IpCTUe."@1=ީS#*E6{n?jMz2(HP4nB}I.{qEA\I*WmcrPTR+tOÒnI$dTJhXQQb*Qqot&dW`p-u.C\P~ԁ€ :ZwbI9{|8tR]>h))DTCb _~[=u3GQ!w/n ?@\{buqD^HayQkjPWd}:q=[e@]V^oa7B*,5eM:$" }\IgA[4=(vIݦU7b߃{zMdt8K(%}?l {^@N}Bq<',jM- ~Ke@x5nF)Lf-kr-5=22(-{m[-yy5C& GcTT`-apkꉩXIUDI2Hofۀ|%ȵ^+ 0=3hcL5nO\פP$ #uȪ(6\~{ɧ*a'_" uGz2u%@ߟ-P@TҋH(zMuN^jcI`E͍'}OC>$4f8dbzmM P#]moڝ7ӗuyiLoGJ8jӤ#j-lA6s[[I#JuMZ@ <5WPBM,?}GD 4+CTQu| @Vl'=}׺H6Cn}G~?⣫ j1TN'U*܃o}r?6csTIaKpHT#R/$ )R\OTnJU*pdc#OP:'S,ϟCv O қ}걱V AWO"^}y=4+4b=y9t7hv¸#[in-ukqD87MEz BˣU6O5?P-P} 9ܑpU얍zIoz/2($q`y6IX؀~ي+Ѭr\]ڽ9W1q6tڹS$d鞍aRBJSͽ͎?^OOu'SS(b0ۙ 9TE-6riDǟIRPPe߬ͦLtV;-F"QP,nڇ7S ЌK3,-BW&е.VXʰ \7}^Fz$i!`Tх1ٺW]c Y'2' Or zL`&٬H"JzWlH*jT?A{-Ѷkў˵Ǹ!/)#2I- 43/#' S2$!)IӋN@ѽp?^~uC=ZY=,΋.CrOq_0ܭ:@AFI܈۟JKaIȑ2SϾ,]mߵE0zdPG#Tn~ߛOi^e#z)CMonqT578X\F4kk=Dm.FIb}%Q-_߲-JzCjtH7WFCIQ.cD&/u!MaiHWm |-NCPn96ڣTF x'Q_lӘM6{1V *: \Z4MAãw6feͿh"b~^x1^(,ྐmQoY~=|ÕGG‡ ʋꆑ%]gO ǀQǡ^ʹutI~Dw[kpSeK_ıd@+f^y>Es G٭ctlދ+/(HAr?=y.>ڠpǤ.T+}FğU+iLr})#Is}@傐_لQRF穷'tiZ"\}9OP8Fyu[;Gԝ&Ga&KAW{{ HL‡+WAW+$~#HreHǶ=T'e$@)vF*H#6Vk+bGPr"H XH6?A(z]B’b }.?'ݺk}o~{~׺ {:X(%U$[߬}>Pqau:f$G"_~ImtZ7u}W,4ߏ\{QN$1j^KMmﷰ55rҘN&J Eox#ۄӤå[F5;*M^9 ǝ$I;MJ=5oB~#2.8~_K>PuI=cEf=,:mey%/{ol:VC^!zAmFӟpY ^)5ΟI[_o}[~/JKJu }`~Mt׺{^@mJWI45:EnY:J(8y*mqao{^=;{ЎAO MA/]Ћ׺{^L8޹M^GO)g ,w{>ïGHdP+k߿7}ǽo}׽ߺ^_[aGP#ӧZREMH;V{~acӦz}{}{{苛O~tT0*~߭?~AO$QhP.#~ֺ;GI[J?9uC: ʁ؍Wܒ߂(s$'-35$1>A{}ݺOҟ~׺{^{{u׺F]HeÏt$pؙѵMY(+`zJc]]l^wgnokצmM62Med[[^];ϾmՆ½Efaćkp>{ȧVpGX2G[AQ+"N.0 {Q)}^ꢇ7si)0~O>V6齮I{w]/=Oujutm ^G "=@_|u߽u~׽o?׺~~~ë*:GUΔ=Cao2?bzۡCB) ̑Hck]n?T*h^$ӏoTs+F#˸Isгjy]3ZfHRZus{_}+Cu뭽emcϬ?ǎ@&t`-?=;Yx['dK9"GFCf[%d8̬v{y)gnO{$B-ZT^*wm{i$~,=$?BrGӞ/ͱ_'3M"+_/N !Tiﵗg)g7_JIm׹uaTt[la iс+[IN {mt7C=".z0[j|. 1[W`{\/k=o+ @cuMP`ydB&׌?ֹߺY`\ʼnäa?ޅ5[q}} 68Vg~/m^ Lr\5}=hRG?dΧUz /M=Vf'y^U2̎Zg`=dӧH_Ϸ`uWͷS:^w^ˌVI%%?vol8oo @-0z>졾69|5~Hi%[ "P5藡YXCuHr2=/cCS j]20id(*Oc$N?}?OOMvӌ÷M59$~oǹt_q< 틫l=Ik>t ~EՐNAi>TGQp?^Ҷ+[SLtEi~BoݟѭFd Uu57HHjLoHGFkOS.rjw1Kksu[lOۡ:p閖8SUuV hbGpdV${Z)3І;0D߷;5>zuZ2%lnߛϴ\lے ?Ks2:Pn){cޡeJTځfm!4W`lukpߙKwp $Zܛ[Oscp8?>N][^6"YCenG Z^=T>u{6aS# cӱګ򛲪8aIO{~J[@Eu3xk[ww׮8%spk_{DT)zEq5=fٻ;qBc)ڤ!nV_0U)ƃn1Յu D4z_~KCoܧE ll}xEX۟'}6 t)ڣUz&ߗɾ~ x4Sloq[J1|QӇCgVH$%7e# igOPTՍȷ~HSGe`"e,>am\ETS t=^/*[(V'߈)Ɠ-ÇUee4aCz*SJ~S{gu?zu}?^ۦq+tWKb`9ƝU_xɹq>C ?%/:k#WTTZ~OEy|Q-2zOBJdS7 {v$Z>o}ߺ]{׽{{ W]Wa#3[+^J^ƒSW$Cyd.tJ~-MuhK|mۤpۀU] ;\ *όFߏn}«zPr_>_NuFOIW#y "TPT\W[#- T mon _% E) u=yLfԊxSUD83]k t/lM<̳꩔2M }[t0^|u}@CJdRyRS;Z/4PoKrOn6<7@݄r÷^!Q408bl_{Nr:.I%(:+4JjRHٍ͊J6U~pLt$2 TOP# =2Z;%43X&IL0j~Ju=bKq'}W :]׸6>h੟A<S>y>ٌw/.4NuKQYQ(5 ;%GSj6ʼni߼@bqt]{_eT{rb}VT=LuM!gҴ#v]GfC0Ԓhu'_k٥zcS \ +FmGPj?xt\=&R6$3q/-<{#|A3dt"a3xJɪRM'|Z측Ηg%4DAͿٹ?Iץ4oVŅځpoLz(f=-<B$G-KB.7>X3}Gjk9Ť oqߢބ~׽ߺ^~{Xay\?EK1ҫ[Y.nxG2%"poc=ut0:;rOU 7*(觖"DƓh$Z`i)ys%:-phRaO@{NV;x"=ZZ,@H'񼼬ъSϫk i1E[U]u 8H=4F~^yG+Ǥ6k; =SGs$Ae+=ĨKzo`qfyH-NI:jdE;_XZ?v/J~׽5@l,}BE+<74U`0*JsU, !V{RCŇ n'qԅmcb- G=TnכܴXM34Ti6W?ZArŻqCGpw6rWn YqUf$Smʲ, •WNˬ\ܐl{dfkyjћ"ߋqz:#x'tyKSΒu mczovj5Uѫ*#~{M~{߽u~k6$U{>]9jNrurRS!gT$os\kJe [D /ƵVӘ*$P~?_yQb쨣tkv4s8\#--,s9#P=@s~{{J>}?ƲyZ>7C(Ps鵽K e!= .[v~ ߻2AWMPUi O{c7O@ԒМuaUX8?*Z ,8`t}y/Ӟ=0}MȽD]5:x,Mzq$%}~KkAnc lgH}y?*qvicFMסZ!-F; H ?uWPKzu7gu-QK;Q$>б zqsE5R+*o~"ke,qr6cPE{^-oN׽kGވzpuFdV q/T0 \?uӥ֋:M)7uV(ic‹&E݁+↡ ac,aȵ{ bV!ߺӞZV4ug*tILjY=41U?$IXJ#RQ<>Xȱ{ॗ77?jGd5^jWr kx$'asހZbXո)X,ca{Hڽ??/:L$o<+&a%Ƣk{)D'Ƿ[w-m:}LDM6 /ͽ'2Xo{)&AQupJSOG]m bf 4 ٙgvbѫy _j-DZ%[~}Fێ-@:0}SzɤfD3Y_xUo H@HKRc掚V/ o|R񲟧}=q֑' =f)9?OrHFh:1-1v}D4ŏV8cǷ ~-by{j*zySש?N4K Wtt#%NQ*0c"?oܪxo=Y ]1ާ(GArKTkQ}$O߳RHSP`j9%Qao 1ɹ,x^ty:_(ѤM qǬ1=㦢Rkçf\UE-: e*a{PR>Q^iᔵ'G?<sӆG^$1`5Y|8\b,M}7f$~Il?\HMcE6@X>{#m?\:0P99yrrA,.HAqCipM+sG&emKT?j? [\utiQIfs Wdnl<*s{rOe u'8݁TtVSS`jihu,ڣ` 8~I7>4e iS%V I>uZYCKӏ}m{O[QRXehbgQr=AIc{<?ۋв˗MZ}no_wd\bTpmZ#>=k =D_~Vѱ@[AS5IK@u4zUH _yy4ҥ׷zCJxUS H#N?U۱\LzjkHBc&]ŸrRr\y\l ؀l XfBAYHHGs .+AN$󢓪Es$ߞoϽSA#n RS=},9*4qko1P+t|8r{o׾"W[{j#&[':ۓ5A9ޞW`?nO>Lr.Zeq"7B l..9$b0 ~/{i=o/:b9("WxPO@+}Vzź5Ǭopd]irx<x$rl/='q҃/4)LDKB<Wީҹ'!4T$]Q~oǸonӤס fߏ|e [ۺt+Y`sy ZH5 eǣۢS ~'K{L.U(z>Mv }їQJ@$1`-qujiy ^U 6R(:ZI:oX}ŕ?OͿ}6z6R$-cr^$ $ӧ1 EWߏͽX oz:TX1JsPj yf P st)  ƯK'@G4е\q" c~?{K F j5ԉ'>],me^l1TVƓ#_Owdϲ{B;HBb; jZZ O4<6(."K=P819zzI h!Q x/n̊n~{JD5 Syc25I:xf~ע褦J(V0 HsH j6Xd)q8{4M̡Bګ?E*:Fxuʳ+IK>x˱!xzzKc j!F#=</?K~}ϭ0Qz=8yER/nG>$IP8{I_{^CsޘRϧ-fiazlz=ՀK&[ #ָe5iV_҆|12gT5L<:V-#Y@{ԑLc/+ägkqP3Pa{DӤ#Ҥ?><І?OjaK2 3l>xg)HYW̊}:_!&S[KS)zlpj+b(i6/1$G]v~_ۭ(F_>3EzmCU DFeascR#'s<::/6SnKT4x?_x}.ޓnI>ץ=%ьy=r,wTV*KF4evۂIZ㨈C"o{>j/-ŴS6Ft>-??>kÁNOǹ4-iolk!0kd(kgz+if[P-{u~{Esnᓡ߸!`V}[5h3OH}Z{qs5c=<zm'>֕Hr' nA> Lͷ\B($i,%TZ6`[/IsF]{@Yt*z{/[C_,3~js~@̾-`k oǸ(Z Yt@}-ȶDQBz4Y{{OP3DY?Ǽ2I\߁#& eJ IяR=D8︐zݼeڞ]bBy Z æ]2 ;Tcb_kY .o'fG :u#Tr9i)]so> NzW5*:Ha{)j!mvѩC?{ `G#اM:aӞ梒z)*ifw`AXc=͸u.ivVWYA{[=NQ҂zxFGPu/`V?ٵR)Pگsr96ɧUi Iku]y" [=zQl_娂8Ye! PO~8pL,B;*'Q׿}WAg#Tcax Ѫ~z *7 R9nc-VlM}ǖ??Ow SKY,~l䌨K/v'J%]$UE*DaK~ ]TtI5dsrFas ڍG9nWIF]p=ΆGO͌ioleANtjJɒB8S.ÛF$g;Θ'w[mHS֬436o[sz uj d{H D7<p!tIכq폧Mz鞍F/ z&;5 ^C!W$w-ANݵo^ QEI=[\r/~Lz"{?~\{֑Ճ VBqcosi ^m`=+M"((@kܑO줃r,o;ھ?@U dBT|F7(#ľSn[/X?xtVA:I[Lu$ssb[{ꢣYUpЏ}ixPpvW?=o(OԷV]@yu$UIV`yGޔi%.54P3fE^ys`I`x#Gm'y:<ũM͏/꾢>qZj2wWU?.8[ʖt47:Wa=K-Q\;Mnla6:,/V txж")홸k?k=ib:;S SsǾSݎUQP"ޣҗ,aIz<䞎hq)e 7Ox؟w='҈CNX&$XU$:Ā6fŠhiT$H?,B* 9N H^CB<.rj,T@sIcۛQ=0$@e~%yjNILnMopZ9^֬Ab,n`.;bI׳A5;Ӵ]$c*6-Et/sR:qV8zםȰV<8)^Sk{''1nI[&VH6$)*koq*jzA[cU]l2z+ov!=SqWbJxOǸQԻH@?E:)S2nl2kӱ:5/~/~i$Y{Ctm]U6wTQ6Vfǭ~煤֧Ӭ?'7..llQ8/-!<a HJk״B/ess$+'+"1+}GqP1 [>:W^$+ nSWcY0HO{nWokІv ӧ~*S'=3AwM)*+"+k٧&M /'i=͡F:^jbUqߞo v@ $Oy fAhvzL &.G?ngZpӥ YsM'I#)Hȶ=idFqq+^lxc,G``??OfQxנ5n)=]$$ه8J,lAGa4AQ6}z^ƿL|0*8Szun{%OrSz3Ymaf i$؂@R( z" ҽ]YsKii `_׿Sa-}!i+oO>-B}Q~Drc{jjӿIB,.TFWH^ [-^ԕierS}_'4Ӊ,m?N~Hgdt!mݯ&fʠZI?O1%sޫ֡fh<) ?yxs} =zOTUSHP {m?ǙYlL~$GvkZ-@!`y?~%znd'DnAX,yGOਃx6r UzK{g@qҷ`oa(cg ZX*~nAtZyj:Xn6%}Tqܒ`.~Mޭ핹H5ٶvEǠfqY1* ֽ<_p d& ~m ZJJ+йW8FU F,ָ[~xO96&ß&B+Nv\P%stE{#U-08C)`LkrϼuB-#}=g)=Dxm&?9^F 1RBF@k{rDTC$+9n<^z/Co`^j:" Q6I!Ɓ2xĚnG%q3EzuHmJfw$#7Id{]ē` \-߁}4QL&YFX(Dּ)x4볙j*k?#s}SN(e<~׺RO\_~`)'<$c\>D{m L%U4i{2q:y|+",v XVD%y JW:bi!;qTf l-vk F϶8@b n?>ǥb4rBR}'tgߺ^< a.}5s'qOOĂltǖxh]LK6ۼI=i#qTt%htRo4*V)kH?*!6z&91hFk^=yPW1Ic_{zIвĀ*ƪ~Pu*B"p:EfcePI?N:*R먟:ǃѥ.~!Yfc"L.-܉&R8^cG"F+tl践Zfꩼk)Āk9vcoDR9>2qP%ĺF|.rͽ u"76Hܣ 06~=P@G_hz*ۂ'Өl[9U+LlSc{ZSoa۶?NnjS VՄ:[54GZ {}Fz/ȚB/gCV*ݕ%ouX}ǎA0J=,Ŧ%E ?ѽI?ROA׋1k)a(ntFa~]HϿ׺MA"qC{s#4} ChᄆDheTزd'?fT}8>=(QztucbӒM s{^8SGO+%G>IT㧠D"0pa *@}Eu/ީ̫ GMgW' ~N>M> W[rO~=5o' Nۗʁ$pыդnQ@H"Q*:n0@zcuENBq,q4a'#21`=*ףWNjcyp=bOϿN=8YQDtxSUT!dRJq~ln܅r&TKSm&"{O O4 c$6crl_q2SntEhء=xڊ\ WQ`/e${`>JtN׏ߏ~!=Ag= ~r qc)t 5O Ωe`/uή7U sSJ<ު4I6`/햢Ȥdzإֽ/l11NRÎO34Vt]_\(甕<؛=آt"M?.);eXcSkoﺊF]LDqޢ$%GӗlZ郯;s QMASqt:#:ӨGtWBȖR C~}u0?G^UTW/xz -(XI<jRMbxiPI}s)i+}T6}W!A!omŃB? $)nIb>v,`OORoc9U6>, դ,m)5OI.ˏMolGۋ: u $}ƕI"Jcn C31:#faco~=Ŗ!9פ!:vTB+&C1M s =_po@ [:Iv-y9Ҁe?|j#?k9CCZtlFIۥCu䢋DDy?}1HQãDFtE07{>Bx? t]*C\6+R7~w;~HC(̩ӏo.F}?e*H`>cd m/t@6eU&Cl#6 \h47 5F;cW\tvP?['iAHgD2 ܎SCG.W~tx#qz*ij x6}=d~{<CX5:\V-$?/K)io%BJWvuuF@mK6,2Fkj<Ʊ$ӛP l? ,Ɏ=h-"yTgtPT|q̎ dP_iGG> ƠVrI&1g~۔WԼ2BO_P7AoqM@??_} _o{\r?{ߺ^ԑ>sՆ.}TMQ-nFW؞A ǣ). 1ɚ[st~R)NDhi%Uk/ϸ Ƚ?xYTn{CZcZ3~ cWD:s?AaC Ͼ~ǯZ뀒2xq{}.=?C}{8Ws͏B5gv?OZ=$7V֏r-*$V}}fgrǀMOdtϟJTTZ-#H_s.O׶dEMXFv{5t˃nS|>BW$}J1O[:kh<:Wl\9:yC2w].ߺ^~{jHNFG:nW6d+$E87}}Qm_Lm[ކ+N⟟n4h9Wc^@]+{[}oo>zӶQRX\{N{u׺k`[?Ol5|0Ck"1Z>US9{Mo;HH<ǣm421ڙLn$xYcgH_54E :89ȶ}Z'{^î`y?BA}G>FV9jMZW4m-㐩>,O׷/#~Isu"i5w{ Aike6}.9Xz?-q$7cs-;+OKb?P4cnrj#CR?,A'9N}/Ϳ`3N3t$`iE-C ׾ߦ:} X!ENF=Ε-ӰGLzw&X`y,]b+k {QEPAc4"[# k-]IUtzI>FGQ[ ڱâb(iуPۏ}i lxCW?baS>W ߏ~'2-CSηV#=$g͹<~cN2zv rIp/kܡN?}Qr;(nS)cy" @R5~sQA( * EϦ8'V-Oj"rz*He56#RD*r?$E#nn?/{{߽u~׽ߺ^W߽u~׽>O߿uHJ6G_}Q==t2F!{qbl.O!}DH݁L?}{^?P=u}^{{{y VMw?[5J GW("ar?xVq~{^G(AbB+r""#3[flh V)bOv_Iz:cڜ̻Y,0EoW:m}G?m,дOWC#UR{ۓc4gBK?BKǤfdzp??O{Xsr+6*"*Gh?[8G6׭Pzuc> m>]?u$rh`[HJ z RXrxIňzEX~,x=K$IʼBctC^{|lʑEUQL*魖cEף@.Z֐pz7-ב8%*Je*Eۑ1ȊO6yXۑʑБ9z=rX|RKd?[NOj6?_cd}w wg#O  x4=i$V ƪƯ{h,{{ֺ"}^yi.o,E2säN\UU=*3;IU*j䉆>DV*-Ա?j}?؞<&w4AokZ'@T3*iaY^h(u kh_5բhZ\B#$JEi8*VIK7Ioŏ\m#2Q:n8% ~>!2Bdp4z%mH]HDMgl e, Έ/-DA7GX$ro1sI#d6ABD_O#HqǿPuL8IIM+jﯩSdž:0\4 V4U)lfچ0l-{&Ut;kJuX7aIIOKUxH(dEȽT&`,EjR}:߮Qua}Tj"oMD(?Y#ܺJ$'+@}< *F[n0vVj*ɀP`U?c 9/?ֿ9-M?CX/׻X˦1/%*;tq*+2UX'Eߩ/6br n'Ư<th?^He&%OA&LmYOJ]V>N7ɵ> ytFjPhd8d(PC0?O~?}.TuΰޖB7 yYx҂>='1! bMLH w=&\ #?RWaž\Nz"Ku1I\)dMJڴ+d /_ K|\ox]'6/ƜYBkZ8rA2žIn"%]Fߟm2,kEf"{&|*OU [B}Lsf (+s!k?>fEM"=4S1KV#evwԽ m ǏDz~gV9n9Mifq_S  \]y"]\t5!66*Bb[%>#}$&Bf zKj9Zc7,(܏diKм:: +; ^b)YߏmSEm@ϵֽndԿE"tPH4 ;qk`۔"ڇKyT4MI7,nH/D1SccoN}ެq/tD>HV~wf(aO~?zHΡ}፤:o6:5U E͋jO϶i',?ofaH].Lǣ˷vX( 'R[M$yQx[CyhBVzW[8Oh>~} -m 㢇uuDW>;ֿ{$*[ێ倣986beiТ-},?#uLo=A :#X;׻mJSIc(b5s6@{xzW2IF@~GaMz?Ԩ_~SzQM!vPI7#ןuj(N@3g2q5|@з5%B*}4#A;[~DnF|6j^?,$F#P8skP#|Ӥf\toոZ-Ikff/y,mbOfƠzٛcJ׫ ٻ= ʱZx"= y&]+ZYnGOAno@+;9TR\0aO~N=zt!XY #~ko?ß*JoDm ӧxmdi4cS,6,U9$nQϾ==u׺{^o~{Vߨ:^Ѱ{Eٕ꣧ZW"t&9dϤs6_zMqi,O]CHߺo3 o+2nx p?ި:jGS$~V#| \lAn}:˯'Z)*a"_~׺:d[>zzU'Mč&"4ma=x9RE}~~DnkԉA㞪;wE9 xZkBϣB30 ፸ob^BLzlIYǴ ĭAƽ2h{Ev)ǣݕU!-"qjprN  l>:!`׿q9Rˈ3ۆL5e]gkDKM}EcbgWˤtگ[ݜ鹿h0:-!z?E)Ԡ2-{=R/3=ǣ{&e֧rJJhlEWⲕvOt[Bn*ZvVFM./_Es=ajzMe]_@@kQJt}FR(IVM ~x?c۔%z(H]<~ W##ޏ[cEw@幷FgAůAKco>}ϤRީ/mt#PrT`"*jbVqZ˨;_8 ')c랭iUFŞHF=˨+Vp-s+pph!y݃syWWiyTPd{hWهAfmFJqM >ZW?=ߺ^ě[WXl G\$9WP|bI[޴O (M%&NQa#D'æXקzz:Z4SL Fq> >pG@;o'(rxtո1utI4vY-[5Rץ J3NydF*X#~}ŰOotWк>{ߺ^~{Gmީ׫Lł!`y7~O)qcSQ[㤖\lQM׻:(Sbmo琉?^Iad5:p橫A PAa?ݐ@o܏dA+DY3xL3ATcn$I=^+oҪvϣjt_(1&hhQI|.P߶=r+^uyк(V>L~mz8C^XEi}9M:ާ_l$";ޚ9Da,t[Z[߽O ,?X{Ѵ=D5tӇdj6aޗ=94V :o$MF{n؁ǽN Od3<х[ܘ$p/qͮolʙcьl@ tnۻk&A+=3OG2*V[JTq66j:nKqp@td#*6hE`OjOsjc)4F̆y<> SacPA`{^zH,i ߏ?{^$=vGh*oZNMudm&F5Q }W"ԓ?i^`bfR?_z}u#{ORJ5Y~2ƲQ_c{-Iyؽy_+(D*MbXsceFD̡GPxa5[gvPS=?s}*:TH5ׁy֊ Hm* %orT[~]\,K=n͖h02KX*?}&uwJ}GQGMv,B$_;MңB\~r j[?Y>1u⚠XdSnC~-25EI E]l9To Q,`C =: z48}H,-׽9^愦Z/-~?{mGEoPXէ^n~G u뎄&V/ߺ\ߺ^Iᄃ~j5uy<1Ҡ»5 Rr]U?Sox<#~C^2%nUI׏fa{Vw/ǨTV{qs@F:HP:\#nyr>p=PuCRkhB' ׿_/v:$h bl=հzv @=5gaP\2DsbGMo{Y) -mU]]RHQb*c1N7odA}o0GGݭfgUsQ,.":~?qngµ:3۷XkG)񹩱E*dַ?> bXƄ ZӢ{2  Сu =E$1c-y#ߚPTqϻFOZyæ:A棯>mcE"-?ÏT%sJcco?dztJ".,EXs>k<4I{/Y_N߻%m|xN;:#Ө)C}CVuN'F-w9fGO;˥p^ǰK@*8}<7),kOe(&C}pDשv2pͷD5iU;vX3X~==Ybȹ䟧_g) .,JN#o )edWкQԾ3k{OO"U>-Z@>{5<&dTIXMƫ{NK7򿆚I,yӥMe e#z{'k鵐+ǡzm0`깲#7W٩Z*V,UX~=[3IA]ՒG$nLM>G'#L.cQq&F4' K;Lq4ǹ {K+2W*+:BHCXnG咘2')cJtvtcF{ *i?U':/Y'ЅeV+oKgXpJj0èM_ǸD=kiVg>[MBDJ@Ajv􋋞}Ch!&tDB^|-MWژWP뽇ڞ* = U=-GxÏ#=Ao׏I ?̔lܛmVPծI42Z*᭣ r۬.B6ٕE5Jtk+qo|] $fd%0c!k?E΃7qrӁKD5chMX;+XJpon/oI`z8Qh.u`'A[=,Cf3YJ>j&xm ټH jytXnxŚ@*=~h_7{~=MiՆ0Zt7ǝ-z}8 ǥlmf᳴Ko GEK%jsпb>*jXadP= 7mʪ=㪪(59 La_`yʀi {SL,k:NE+2%&py?{O=›^IV6ҨARcϿWR=3'σIoR@Wk[&Vu !x*Ot7 Ÿ{}[ zh8I5ߟ_}^xµ?d۔l8#XL-Y56^V%O4+"G΢хyP ȿ~=k'AκJN_LFJ Iʱ)OdQɹ`}A^doI=BF8(8h V ҫS3^[oxCztIN̪5IR~qxsow 4dSp6OoTNBQX".Mk4X%4@*zy_$ϧO~ *D#`=#15,Z_S]_xDv88V93A٣_ـ߈e呇oz'ӯ2@[IR)"cpAW>jNӦƪ-{No׷:o1o~^+[?Ou#8Ө4Q k{ȸR1`ÇL9z(cT#*P@ XGrbi48cQN{+0h$8Ss.k<"E7};;_H=8}vL\(M~~^6@zPmmO|D, ?7܊VoooǺHm"}LGH>QTe* G#V__67$ssϷiKXkARSH+@!G_~=TW2A(C\{uu,NIRGAzSm+WRMO0AxAI5\7?ԡZS#g,JPS! `]ToOҏ(-u}4Må6xn&7RK1:7Q ^yK,qqM^xw +^Sdjgetf80t*!Y"RV ޒnI`~.= ?xEAXm3] H2\AӁ5Q,` #bH#SJ>뛨n ٙCTEɊ@Dm0FM?{qH2ċn&]+^i`^\^&*qӧ튤+"6@H{EN iՁl_-Ndc1T$F΄ѿ޽onOt=V)1Ԭ&A=lyƽo`>&WN&/#, o_RQ /f ~n? //GnH-z-1^Sl^}&ǝ7$[͸{I飺'M:ttVI:_-r/om@'jSjњZeV(%_~Z5QPYT({u{}z]$'W oot?.0zO:@eԟݔPufmX= r)OſV}-b>ofZ&FE@MiX[عۏzM]I7NS>גc[Zے?=:δaXDE$pGrˤM]?ץP tw%RM$B$ ~~Oc.WCE6FtT-'?z]M_z؁=LNU:j/HML%Pc?= 7鮜DnՏ^qSJ"Z{/1 j@YWcFPo{C%Fz[S)Y@cbs}k#?KX-c@i'sxcu%јۿ*c\UMCcYoYwqoܷ[e |4Oםc@cD&m#THH,p^EHRA"?oUqDS$~S&H)XT#ܟ6 2ݎy #5(`8O4r6}פW6l ;sQd> >,=ҕ2JOTVC!F"4)rOM5*A ?\J(tԓmYZVTܽٛ-IYm.3()TDE0Mmo iʈ9&Qʂ'_7?BhjJc'$s2[iW-ײ8 ۙ(fXoonx7%&7Q= 9vH&,D`JCQi4+xIn=yt4<1f?_xHF5:MqkLtۊ=SU"mci:"L޶Oj@GN e閧uVqMttTm<v T$imS=>뽵߲MO ,BWKiCoiLthZlU+&eJq-:pn?I?~v@7ˢǡ}"v(<#QRTTcjn8{i^Fl?ݕ@3I3z8\N:O F0B_G_{45J?$R 1<mǽ=A#/,J*ZHcf\"?{UBUA-E[vV2RfkdaRSu):*,UKӬPJU6 XX[?xj4TfWW'\yP~=|(n=t F!ъW%e$ʍǎMD 3?xyiV5=E-]xNF6>s ɿofa 8*SѺx܋UI# fZLj[tkֶɹRô/$q2RM@,y>*iE{~KЋrI0nq2%=S>t2~Ofn CA}EG'vV.5jr"Ʊ5հXOb=*u:/z: VBgRM2$΋_^aSbċ'}AR„φ -%*qu']hэ-a{}o|\}{7T[X,nf%$9i[LMխo{\#'Ō47:5>V73"- "äFKt%]Qen/#>?>J@n$:N}ޡ5of* 2I 'LԆ5 ?O!K.׷>ٝY91ޘ2>+[?OjEӡsi/oKkQݭ?~iLu%H`H @b@ÏQX*^( M$~]v3wz>nD_XUqE?V<'!\i2.ʷ>Tҽ]nףs44sT m?@>#\X|U^jkejb:U4TDrXm°!-?ޕzx[T:wƔ%e]HHȷq 0-ۋ^ }$*-_}Tqdȏ2`n/PU<t$)p5äH1RKI2%JpRr?lDON'Wj>ŮCpCD&bW=Wm_McFN)X[{k= Oua9] uB*=y$SR)4,eaO}Zn>?EzzQ ȯL&j_اK,G,.<=/sҹaX< dX >g}玔"3(f}U/<ҭ(U?װF1u&d ,X"㋟܄LS{ۏ :1!O'SL1u]]òTfq`ջDV&!@?P' ͿHc@/$]Z:v5k.n  ? l{5x}_fX`tIw% dӣW,O䥫h:Hx4զK[fp ӸM q)XJ0>bh&B[k"S7gRb&SGX78^$c]DZF^Nl6]ߛI1* ݬ9Q)wУٺ(QNw4v/RޘTtR8/'EQLȺ挪eo:zn8s"MCݢ0Ӟ$ܱdH`؍ ox$kD;o>2 xt^($oo~bGMu=n@_|AŽ uF`$2:& #݀zGq)v cq0RRE:GPXO6tu^mnRrkAC#|_o>OOߪG6ןu=uŗO\zj>&}"KZaԮX_ߧC"[KWw)r;8#Z&*Zkn,?,2K(*~9KemiBڎ~{D 9m__te$?\V`&\2GO=+c_xT2M/#Q-Pۛ{n LfN)22jyc1ZT~=Fp\Gu"ul %q$,{~oߏ>4'h$t!!ŭt+(9[r?7mx隐nL0M$4S(e,IaJ pV5uW|F=G# M*96coas/XԐ6nT?]{z  }j6?dpz+k!e8=ZEMV vX#!e#eԟ7}tMM _%_mIOo67n|xbqO66 k?##Y{f6`+/ QDoqe0TbDn O|`cksNTy'ϪYz؛3]?$j<\YyE >th/a*z,)s6+ܐO Gߏ ѯˢ(ю:4~ǥIY2XmLOtYFåRm˞!E I'W*>' 9\ݣ9-f_;b2V I-‹s2,H}Mz*eiKPj"WA?^G'a W 骮*`+kX?[߾]SϧMQ4`Q6q}l>qOVv:EH&\O{TX5[Fһk4:Hnn(:('O$\O2rG5ghNr:˷w,[-TΥ$<ɿzOtBMHO/!?{Z A~w׺>ۮ25]}.DZFjz i*{Nɓw6I`#$~=Ϋ,-=2LNw]m7z勢ݹ%I=.Uj*O)BB]nS#gKmRm\L888bUPcm"?=IS򋽿>S~RSO. {qoy%BzFzzLlmզJVVM-fK"^#?̖dj8daAG!\JzbKBK(v龝}߫׺貯 m$ \<ڠynMOBKi*4_ϷO4al{HOB#E!2L9G>PLZFbx>֭)NSyKޢGqp&#cݪ:k}?}{ەBӛVxpj[C+WV p/Of.w$-Ղ4:Sog}kqoqM\$qnasҔhsok]?>xv3T9$-#or9m%mKeM:ϗA"If6午>uJQ:&Uz;(MBGJ\"}j6 |+^>0 HmADRU'Hm%Y|HCk={cLWתNݻwyA]D&$_&Tsكqrlo@*zA.2jzwH:ƴ"}MEAQ,q%Iж+GUswe3ZyQ|ZZѡqo`g)?}BDwࢃP轃65 XK4Kc&dAyQNgc<=CLʌ  i\~:I#jr+qP( 4)"aǼ{N,EP*Q7a?}$Z}GM1k4!_|xskz9htŘe3#)(x?ߛ{<{[IrzʼntXHs'HS-ܡyb%ttvCwUo͖ +~=@gXVOEPjIBO9X{8U4S29 ] >΅2I#GwQ >[<?\ڊOKUU%I"A n/׆.qDG;OE6EF);UXoIRM>GM_GV~Ϋn 8>y QJhiM׋~OME[Hmksg ) GAKkJq먰7@%SJm\X_ YP[mn?/F6b;a^¬ ʪA*BྡsbЛ[*9[tn(xْV𚳳⧠-0_{nm;k-"dGnOJiѝȣKMH؋kx~cAQ@?!'կOB>>ziiZHAg<ÏOz)PzKML`b>5:JcGJ|aD@: \樓'x7މIңU:*$'S_ǷZc:$hۋMq= v<=Wq|I B͵?Z=->&,:$lJ p>۲Z"o=F4+!*\H O؅}??'O@BL4y&86*}(MDz10Q4= 9# + > G?>^ݨ赅  p1hcf1E$EuoſnG{#-A($eПc]Mݻ],>7yPm se:mϼմ~xm+G[l ))Rj܂tb+7`:CN4q m:@|z ?{{ ~9VO۸P˦ C&C=4fl-ao]g9u z~zti9$?Aoxoʎ$I6O{G^o6~w׺{^S>ot-w:AoxP,G%#ܚ( ~A ŁȀ)uֽ#S#S*@߃m_?tIрAUGEߺ\qGu~{F{r9jEAFjåq~1uyCɯVIg{Y9ۊHڜ@)ZxW ވJ(n |ۯuPXA߽uȐɰRx$VRG =?43,&z dVZve7 -%Bʟ6?i#d,Gs mղ$Աf22^àѰWk]H )\{%ߏ>B3ٵtIFm,ok/T=_47ou'I? \0\=;vo[~YD?NBˡ"x[v+.窚I/&ڴU&ƍHSpxA@^`$='Y-=i oUB%rkХR`4&p9}}5~{Wߪ:^??}G^{{\}?Tuî $jBc?=u߽u G7?Տ[z$cC%ֺ`>}^{{u?~{H ɿǽue]GU_k.-solTsasOtGGr3_|G_ϻTpW4E c/:?Z'pG߱׺Rږ\{ {m)1vYi!&F'd:~GPʝ:gYB0:hoMu%i&xbq%Tnl-&?wO TIG?E'!pYBGX"'3e#@7KX8T0Vcm@n}ؑN$t!SQ4"#/kl/k|1EOOK>}3bsc'4ѬzV"O n/:P[5T>:#JǧRxGLs cu7т\]bָoUiS2,m hH2 8V]<&#M./ˮ6+iЪØeDo~Ug-Tf' \1-'jŜ珥{Qklm֕zAnt-oF\Jd^xթT ѭ8o:ǐ0x΄gnyҭ`AB~g {ٴ A@z^luT^HoϹRxZ?m}Hh\f@jAjі8s` nN>)+pmߥrz(H!cG of667[.(c Ox>}q7{k.dԆUԔM{ʄ߇M4r7jtG[MkE鬋X}QsqoytZ#bm,?tZ߈d3UIL-\@BIĖoo 2~m[w#W _MyB7[g{6qVcN&OZK?K'{7Nzh|[[F O QUn|̿~>\"5i۵ +4BX~,QP@}' g!:r`ʢ I saL}7 p9{]`>afg|F텊}4F ׽eFbTn8 }ҠףS(\ʢKu AyQ =vݵˀE{{sT JR&Xy$Kdd2ʽmY9D߯%_u|NǶO "p~Jx8nNN~C*SXgP/j n >@KSN/.@)I*.sPƫ#CE<:QsInۇIݘ]]UA@-+ b[})b\?N}豣 = y42>n<{GMe)i%a)HW ':g'cjZzQ˙C`f_2ơ~8UWBxM4: jsJzXit@Lu )>تډI9MEZtٿ aۙxryOi1atM<{k(/P(cٸm}ұ2 *>q-[۽#mZW 4y}u=r3v3y]*<&?-4ib~u#-u4UNUSOf?*?O6 ލ|ҍFuSP\x[{azyQgMT<Y2Wכ{8?Q4 S^CS tfȽuuPq6{kRuĿS@=!* UW֮@`x?pQs [XT{*4Ӯ_J qr>EnO+Fzf-ҽ;m/zPRuz]bg t`4rT ذ_r]Ji#Wѭ'!.]$`$/-ŀoqom<OA#F/Ac ŬG&8.k <܉SKho>N"*b`S `#,}垜8-mGJ/l@e^=&:}UP̘jv@#m7?=D`=7dɍg#.>3 .m"[,xF p=Z1ԍ$(c=SF,{k׺܈ ,OmϥKP[Tsqm 'Omx_W7_LMEuf㮑bEYwuX}?Z^EunGF>:%DTѺ?ӏ}Mt׺-n/?~{ە“q+ˡoAJЃfE꓅=SZc%vfXf XD/ڙUUtf2z#b])AǪugۆ#[Q[%MLӪ C+{GG>}[\`Tyu<^BI!CO"FA! ϶ٲMxG kn^oA'togrR*g #JǶ>ԽA,m=|Ƽ:yb+^ M'U]rG=7lM:sD?{UO{^-{ߪ:^`VQaOTe_nX_kҽ luתmsR" ͯ=Mo {v gHII^q )r$q6!$OϸhoKOEF:r4RYLNsZOKeYcѧ=!&V;F{'L>E+җqQ=ELY^Ԥ8}r,~ A)NڱQuj%K,Oq–$X7=+*"`[?tqғjBkIP??>(]?/z:y==2R_??~=HueF ?^?Co/|@O>׺G>ޛuT/(6$psiG}!*maI@a;؆v2rWI$}.oڊE@l #>óHWR 0 5K-URF=j FGվ]!a`=z` B@ol},/o;Z>=>;g`٘!0o9s@}=:iB {U>a{ _Mۦt߿u׺?o{{9׽ߺ^~{GžQ{{kx?׺6&βB~'"x(Xn -fB*Jd^7*1jW) H=iSa6}GZ'?Tu^[{^ឺ A>9K.q½D\} i WbI`~~?_~K`,{E'[dWZ{#x`@8%_O~wu׺{^{{uX{?_?coz _y "))YIo|X\r?zmWh)_[xGR:pҮGzjuxVzmV"TC~ӑ\lvB|A('c2WGf07m~?G, _},Zw2Zt56y84O0ɯI'f]< nܟ<}IWޛJ4:IRuk$I<{#1iB#p8')>ö΅7VIk~=2nx${I%)Aэ-`ϟ@;<@X`8IHqHe'!X۞>nd_*tid6ЉYɓyP$ fV^,?Wi~i) 礻N*~:o;!T"@ 7nm{ھ0 $>>{ ?7z~wJ׺ޏ9b>jt8E=5*#b>=ĉ-;f)+~OnBl{pMeh-e+ڣT4QK~M*(!Zхx AB@g mj܋f5m Fϧ}[O&7]t.ā Gגs--Ρ]>}GlUAào+㞐P/e <%7o}8HoV_[t,5kڤOE ¿6omI##j <ϵdTPgd $(T ioywbok)s*#ͭ钮x)}(:A>0T=G?A~lR8N=0tmzB"ٔO0\_z4N~ W5(e&):O<@so{LeGY"=Y^hdO7:zmҍJ`]󸒜MFIPH{#$UT{>q?Lҋnꡑl* gS/,5X?+,$ }?bpsg<;j`WPSVOOY$@[^xCZ<=O:L$5ץ\ t:DT o6G)3աj.z`izHŀ/y=(#l#IVJ-Q<`A~[-_b7SD=/c ?y]F?-gMMsFH$ž_|& [T'ƱXX[۞=Sr}OkKu#WG,\H|Lg;u~J,r/:yq!X_IQGۦnFsP~n~JZ *Y?5ہOi_F:ʟ.'G Tl)/k}}o/~{^V{{_Ou},JpG}9lH=СoHԊ,V㏧=眫 ?( zYzOH}Cs-\3cS$6*Ĥ[n9H!^9ݙ4O:>I6vݴ㤒/jl+ P:}C&rIo{ Nza'OԸȢ"Nf_Ͼc'2BGu8X{XczqϨ42eϼL5x'zŭ1ƁZӠL2V ||^C+c)s xʓ77co!bƭ88cDT|u5kָ'kNr5BdҬM{/Q?~vBz9lU+lS+$LciYH65 xƀ='rN83`ciܦ]A/"M_{~V .>{q&z/#4B^o-J鴈Ȗj͉TcE9u,)yt۽9R mq)gB {ߺ^}SC^T 6^qߋ_zlڏX(M(ei|/SkA*pHjI "?,(vDh#ʈ}C}?>/%^ﻏ׺H㹹<t8*g=%3Xk#>eſi䉨:Ag=mعݧ! =DGkmTWsLNe@g-^XgV,Rڍ,D9@ km@Qc}Ztq=fW:,KGVηAl!Xע_ u &Î &kp\,#1!ǪSY%HFmUH7=-ȀnI.5G MCF E0y6U}(zI$Q*Tkn}ƬQ[υt[ACWDwm+->i<k(nYӥ]u\pH9p, l}XHBCLC'Kv=8!1?AL;3B%v|yhp9~=C⌞oep稽 xݟ=,fZ| Lj?>5G }#s%nm'a}V"ISEAF?g V[+X?>hZXdF5>_q)}}RR[HB}z1{o{ecYG)bmІ66movib:YY=SMQva 4䟠#-!G[\_P]X`g0KM=ItdX:Zq IO!R?W{(JLz[yvM. -u[N%`I~g<=V#6ލ| qG$JFlxU,I@pmsڻ8>}rvEF?LfRZ0f[2 {s&Y~H{8i A $]rmX_ӏoTy<]wq>V"ۈwpTeOtJ>ڥ9*Llo_Ȗ+~,^Ԛw-؞-:ieuԻ3q.AkNd Yrl)/9g0d  _pzεCMPV~Q#rlߋ?r:3ש%>SH٤uEU^?/x&b_`]&5KTL"xA&x[ǻztfU\@ ?("%Hܚ0]Q,-Y4I{Ҥ oͬn>v[4{Z~­O"b4@_[z=sj V۷3$駷j, ` : E5ۤ Gqk8U$B[,ʽލjv>V/8gTG߁kb,TTt1:ݩS6KWpmj{~ :z-(O<;B"pHyxXC[h3LA[{J]w%q?j㔸XtMgg"޴ ɗ#Ur _{4;l/ע,iONnf{Lj)ё8nW5lrΰ+Y& x)?<>W)Vi'Br`ŽWNY6u^OmY}t?聗C+h,W܋yCFATN ?@$<{Ǩ&(]B-{GZ럾u~{^{{~{G[ W2TAG~?}h0z$7W_JC5i?~T֣㝑hLUZ;DBY H?4d:E*(GNx񾡞r6)@rCZTN>O)N:pV۔[ԑ pK@~ (Ԅ|_RJlEN6X¬̯k~^h ]U<>}MJh{pG?% J`K^뎝.bҵ+1=ҡ2WV_aB-uTқD+o*wd9qKB̮.ob53mdn t kۚVK6:tȱbGГ ff133XRGƧ }>LŇ^ewtco<½hvH*H$(R,zH?GR$m=~Q3WM˺eH*HZċ}ҺSxPO/xF~@mZ^y"ȓbA|jHO#j{Aӗ7Z;ɯP8՛P^lzNErxjz2߸BS@r&Jh$\p[FWץ;ImkU9f߯ww  +jcnJq\d^ QO9JݭLWR5B?$EkY-6ǰiHkڔ:OU#C_S s iYc5q힦@ :VAU!nG-.k:o}^qVL57{UTX Xcs:uΝ30eMύ$UP?OOuIRl-{rխQ=5GBUiå?Rt]O5"/)bH}_[_ ?Sʝ ?Yխ?>oGf~]ooվu"moƇzRzֲ D7>'o֛<}z.:C&o~}&Ei}իNjM|XHYkp8>բ]zYFF]ȥiGOf׿߼*t}InGK,Ց:!Bn ױ؁} Ҭ@bj'eznŹ$Y,Om,.oϵ`eMGF– {IF6oϽjd("D"uO$?ouV%cjH`)u>>4\\?D>_z~ඳ7`>փ^_oFUT( {}{ߺ^ _~<:FM<ꑖ=ߑ}xk)snd&z*f0?@E>IV{fV$~EkwF :]GMW Q JRYAsj kȸU*ƞ},+Mg+Jō?{wP裡6֊BSֺ׺~>OQjiЇI{[on xiͿ-G})SǣY!t e3zx( : '*ʲZ[{qipeI4{} {v Yl ~(<׻O{{揠zz)f1!rW3e 9aS=nyfװX?ksur?ߟ9zt'fDSft[.}K~}О>3H|k Hɸ?7֤|qJq ,yW֞zr:PDkQ4kao=;-;}3zJTFvNHs2Fd#kǣh OEj|[tɶ!!9L>FolV7{kD 46:3̓ƲFu+}{\s/~zrҊK)xy> Ss}@oըhMzYNjb!KٯpxG:OF׽O}ݺRߺ^~{߽u|Oz*i DnS-!~>=YOPѦ_#}{O߿u4lIeȶbԯHsEOUS$rf6< ZPOpnq bjI&,Ů9Ox iOv9+Gtɭ[T M/?Y?߸pꪺ:UREO UhY$-ɸןlʢD+ã=)ϱx9pp’!cjŹ`GX Ƕ1dَ9(zFlSP'xXF7ێ?`p8*Ǡ:R[(ko~n|Uu0^w-g~4&'n-Z_hBef <:2,. ȽV׿[x& xtM&7-|;'4)b7k=H7[5S\t #~pyjl$SSG}$@?O|yv&5h:wXR:QgZ0_G?׏t49FE +a82 f }n=ڼ||$ t=\~b8R8$h¸PFmeozNʭ4bFh4ss~,/ $i9C˩ ׸ SU_^) VNBGwNj)yZGm"\\[HBǨdb(: a44 a k.ĒHRM&n8>"O֭.yux =ӎH[#-c>ݖosehڻN:ǹDTM)A"hpڔVf`;}{1U!iZē:;FLvI1kZQ{Mҗ_sk{kJ2`?/aܟ͇R]oSzTcԐD}G؏r)biG>ۚAo.[53ägo:0#KNOLſ#s]*`vȬsl͏F*+ a:,?{K=,z2U-@oj&s fU,3-kn4Hߺ[[ƃR)GĬE"+C $cujA7F% {{+^v}QӪ5.@}󎀵1_7I.Q ~Ξgy1=&/|aBƇxsĪXvPcYeOYf+[N"L@8a>=j$ n}\ūEsכd#מQڵYY ڵh^AnϵCVRTt?%U451O~ԏqbmK<mlwmHzO-G5 BҀ K psk{ݺR=NQQgx̄\4zm'O[߁N4:EA麛.2xdtO}sozxe,[tz45 LM4/1>b>=Am<:CM%:?~{4N>^>_yc{58D67I $*H2Fc` =íM zͅ&^'coȁ8BjzUk"Wʸ3uw> y!sowytx$c.p"SyQ,Xϼ~Ǥ).߽u~Q"׷*4-]ZR&76O||ZlM=]dE!RnI{?O֝5ӵE[BkM#an \{48 .(?۟}ߛ=u!ԆG=׺X`C _X+i(]#w.-)4+v}8fUp 9;*>S43}HJh̺.UV=?Cv^ar#^ Uit?pPÑŇ:,йC] }^6qoqxt^q/{r~{߽u~׽M}꣯uRڅ}^뗿{^ž֜:Ȯ,C"~K{:밠K~??` aYFֺO2۽L76_?{р/?ן`M:,h2('E+ro߃ ?Ox׵ P~%06/Ϥ{_v龝oz"oUVA<COi:P-_ߨ^lԃfR,GA'}[[zD@oCZqǠsC_IP)بXߏ }?פ%JK Fnm{=ן&Q~{߂$[YTedtjb?O[޵A=He5H{-}ֿވ=oQ:)W2HM WsEj:zS M[lNn+]~~>KqkpE:cˏ9hKH"vv o힢\K{Uz _2XꞎVwH_HcNTN{POEHOC}]OӵF@:lOj(bX`E^'m;AqǪ5f\JtK**D^ޢ>mY&}7< ^d^|ʷ AIM΍>B@ M̌P[WmZs\8$G01F8Qo>N)؟3k$YGy6A]W/3}1s* DXQlosêFNz PckO{miYX9 XԲ$WW%7noBXiYPO V 5`~E$} d`/}(@߽{Du*i)pX}I«$#=28pC_`dfhqMIfqǎ~x&B FGI_9\nb:%S#(طlyt4ִ3⥝ϦÐO߸TچY.iп ܪHG?bu_F~ AP[E^IX $)bgs׏iF#2O@:=ZRAP"p-Շ% `-}Zx'"=ݸѷ!XL-KGeIKYUpI!v*+@RԖ'{n]mE oi3NeyeޞMAQ0D2u^=(kijէI=͌s4q%} "O>tSQJMrp7Qp.=怄q}Ѳ1*:OzJ! D:WaӏeS[ȧ]j:Z_[ȺDy=eEDJ.n@# =`V콧4;;fB+^~}񍕱:U-@k8^RT7se)'E{ΒZ!$kh1ێΒ\6$%]ICPq)mz0s&栭XÅGR%I<=?er R]cTO-Ŋ䦎j =Of]w WOk`FNz%Qh 4WE٦k6_Dt`H_jCâY"x)PeET3_}oxQ\[psm]A=4Y$XHK]f-}}e]kЊo4qN݈>9KAR KdrQAEۚ[-#k3 {Jġ@8|g*# `sTGů{Uf|%*q{zj[ЃdC}osN}t / Z׫ ۙdSiĚ[Ӧ~@{~mu%6|!7cܣS_iz^׆>4QhbX/]IkN9B6'5wG >O$~9'ޟ.ԥqӚRS$eX~zȷߺ^E=`46ybyy>ڕK!QU<:D.+r8Sz4d^>{W$n[_OmAƤ9F;Ӡ4S$v;]Nj![Muy#?®ǟIϟ8Z[(&?]+=!R/pI~NH+ԍgoW_TK1}j o %xQ0C,~ڢX"1r#U ~Z}Ecl&y86p6Ͻ Ո'?DG~yGБ%eez6KxtUcUq.Un qR+ oOwoFZrU|>ݪ!8ȪA/:ǤZ/>A@qX?Ku{,>¾]p&N@ <̔$o+J,uEH텤4`BEf9t_v&SPөb|Z(o 6./8Ȍ(ԟmRҝ%F  %:i% 7z׺{^fb`Oܲ,kWgkR"wdO O/"{ۓK~Ia[_ízͳd[R( /*@ʼn n׽~I^ ϶zzi|+..T^VhzkyHJ/#=T F S9$,G@[CXO=ȺtJZU[G̺{ZUTܐ8hT*2XEetH[{`xugX5#teo%SǾ>GTgYq7'{T2فpGGֺ~{Dۓ{{{G^뎥9?߉׺u߿{^{{u{~{߽u|I#~'`Y[p ~ &bmqmXk9GhJh2HqƢ=^B9cƓ{}5}=NKGX؛)`F'WA?Cn_M r}cP8 "8R~=U?O>byt(ⅿSz&%51 )FAd ~W ]<ߏ[X8Ctkh@?M|[CWi(E0ܟLϨX\f2AK_ W|;nRVl p4]V5dO~Oov"+oVfI sQQzWM`o=-8jkыV HD^=}:^QSt-tfkpnl, XO F.T:QulЊWlnz,`fQO}}:@kГ B aߏϿTuaU$' KfHT(ãe4 =U:9tGE66 []d"gE#>7eN>*])WDXbSffIV}O}Z7{^{{>z]XS+ .qӪflG^"Ž LȢֽ>AY$Loifl=vK^;WQHdOs*0~Oɶ*x|@F+\4[5-bIC cJdK?ZI ƊS<2f'=h- 2ơ ]:?W Ͻ ҟa 'z ijCƠ WߏD7sc턉crqYZ!m &,T,G>][=QQà0bkѝA)hiU{{ ǦA#၈֑?[=r_{>]n2$UBp]HJ ?O>.cd$m Vm.ɢUxRB]ȽǪtPJ~=i HV!ǡcwuZJD&ky?CO57q϶'0k=\[?$coj{cx!a_~m].N{_op&ZN9z5;p tӻ$Z}mMA胇Fj'lީG%n؏e3N(qЯn{ZtIK4wYmR ?ӈU*jn?Nh8t3ub6JFJ-kďTQ-_S"˪vK7YxIٵԮRh~_>㾐t4gJpퟒy諍dj* @9mUb͠*-~ltףpPJjC)EJ o|;_=sf'4=9b׵L>ir)-. qe<=,Dr/~qSН yH)K5}<{DZNX"F XC;ҙWAiTnA#qIqH@'ˡ co6X}oi]+"[yw##V#Cx?/S$KF=;I:jL&CiRbޛڍ}-o`9>$тS 36q҄V:#1mR~QR}@+2Ims ]h:@a{lfωYp-QrHП=Mz*+cmǯ˧2S5]³)R׽+O6}ytt]"m> Tk[NX#=n dO˩#䞠NplUA0$H9o: ZChONNdyIv]^`'/t)4Ǵ?[y=#9՚wRcT51D#RH*9څ>=H0em*RMJɡs;JCV8,ptW6+>6;9^']{=/1ũz`2h  /o@hqů;jR t1mÖJAnt{`<?}E-iPZ Tcj_{H*~9qI`oo=!"2I-mB{.oz&P͊u2~?]X}ԀկJi Pc4="'cwST,t؋QY)Q<Z~+F='vM!U]xxH?H~pO8?ׇNZk5V]ieo{R)J)@ ?{eRGzqft]*imNUOB>jry7ru}TzuPISmG;)VG|.M6<lY *|r騞$pHiIfQ{GK8R+bjx\`׷qye_Zk9"I<&KHYO3d7E5Bk?ۥ- b5rG'?WW> zm`|Ӣ]ѢZ7Xζ+ͩ#O8Yd=6[|.>i~2V(ځ6ߩx8uթc>7_@lsCRһۃϾmz+j^g1dIx1~-UJų\WFm´U1J}'8aR?l,܁tjk~CQ 3%;?ԥq ǣ9EGH<_mťz?#[Fz-˜iYƠ?,/%]8- ?L'Xb6 kЃӝqko ByR,z,?{ć!6:3[ έ$.\?A>ߋ?_nNH!QYE Qc5%W 4?{@'h:kpͩM()=jg,?=QXIMJ+h8LT*#!ZOŽA[Q#=dN3I.'{);a-WBV=iA 5M: Ey'ա[+1z'<o>"bPAk$..RQEM4je,8-q8<ݨ :ѿK `^/~7ੱ SQǬrC˦TWR!?_yyM狀J⼕ H̶W0*XsGSTG_=RҬpGe7nN{vVƝ\cq؉~%*^펨+[&= %A=/­zZ$GH?G:d:l@@zL$4Y-V;HS!A?PEߩr.KXR<?=.t4yc; mä(tIXk[= FO]FuYUӨ}征?_mҝB%*);K)ŏTHC5lh曆=F6^%5;csp:O,3n8\E.:*H ~/q}k䎏9ptZ]CRz±!w1,Wr2Z<OMX?N9ƲˠgʹTҍ }VW ]8{2z$t n_G[}QFfX!CKj{zjApAWBؒ0i`j٤z )P(}&}>IOHtٌ2GpEA.'}ۓewn6v."KȈ^#ֽp&䛛j ,js 1SƱB8U߮M}=vCU4M-b誁&K[Koy㨓f,UkP(zYܴ5"7 iVhP+-a&ڭoQ[=/g5)nɷ*~xވlK?_ǼWזEPɯzW6B ttݵ2.g7"op=%'OǺ^XN&g%c*T zE@VC@:|TzK@?߈6}?o,æȻ~@.6?ѓʠHmAncaoGm].ȱ8T;q.2 -N(~崂_fplQMQ7dX},?>+8}\l3GB}ȴ*v~މ7hmG[]@b)Hh?Ҽ.7yu՗'0LI8*co@{uE>ϴd]Y5zzaOJF,N ěsɸ֔UϢ(9`jѦ81TXLTԟwV&_5BӶ&ֿt.'o/_dtdݥ+*"akSsEP>>-:Qq=yA-\:W @jQo5^:~ڦ2S}x;Gq^( ǣM[ͥa./ry2&`܋sϺe| 6NI1@6oq#*qyZÞ=V>cJ)P zRNv< D3 r<~?}tGBɷ:ys^=IA] ?Ϫ@97HZ!iXB:xapSiZL6?SDcQ:7Ӏ뺷lIv6:~Z(ebܲH܆}=c]!F}v(Iޤ)W>alfgڜI2pTة敍Ûo􁞓ݰ'l{kn(l}`$ύu;ߟo0nHOzdo'y)siX{r@}TjYH{Z*z ]Y:7JX*p)'Ht2@G a'Ynm8M\o G>.j>VwYV㥤Ht ُH#bW?oj?zb:|iem5-tlxqI_mNd[XOAn̉ 6[V }㔸ϻTNxu]UTU qyooQZߘTSC @ˬyqj(2oo+E$ZSjBHR+^[G'Ss AR N\W?oi Oc"g7k=,0*9'($upkOPMzΒ6W*f L1RՔX[m{}* \C9"pF%&E,* EI[7[(Hpe&(:0ո V$ Ge?i's cmRFGqPU2#t(GJqǾ<c7ӃUb~I6OuvB lU`*l>=W_kבu|[X)7-o_wE : XB4W{>]YPX*b@Mj6n?~)ֈYi$,A?ҝ&Ǵk *q$~#]{ #ȌN:w\Oe21M+NJ -IWES4mrrI[/w/J}^}u uE,Gԓ`?>ƶuf}1+҈`t5Tc碤Υ$pjȂbٺ׷O qF pW%J#-DQ0!8_I}SN-iA3ox Ti:^@:,`VVTUrğcaF<?׿Sol zz byYKD#~ (5'ij|t xv7,*>\80zK7mPi@V2-~?{@݈>jpp̂t>9xe齹J[?{bZJ."-1y+?;TWEPbF &;$oO#A#`¾KI; ΰfƏ<1 HRO!+¦~WO j_wJk=x5 SHDD䶯s>LפkҦttӧLj^r>-o~WW@'jX5:_ist(iV;,6-:{1GV?էO־B$7 _mN?9:a[9I??${t`P}=?}{_o=8>}4PU0ȷe#Wf~ N.H"}~zOu?_{^}XVr4MX G?oߞP<{&2 c\j?_w鎟#;i:y7ܒԱU]IzHo=E1mº*/b}Ξ-ȷ<؊_1ѵvֺ|@_^-YagTj IOy ēCOD$A= s$Ke, Y7#O߀4lJ~Wt|*x" BفmV[:_\@PmcǴv&xѥKTN ^ܩ]L(p%kZ{(̷op_bz.=[v1i<z.OIۋڽ1C le΀m'@ >IjJzQ UpwG ϾNo9sSLn=hCy{N?׽`M>$u8Գ"$9hutTMOM*HГCk[|}ۦz{}E _7IMz5c>Y>ONrz&:P$h%UO_|eϽ=] lr~Bx |ݩ=>#kյ7XSB ?I^W@{k׽ߺ^~2:J"7aozXn=b {cT-#z%G ō_}kX\ߺרGJX2I ߁n?)zX{^~׽"׽̤XSon}UѮzs#_z껰?g\JAZUJͭ8Qsh#1Fsϋ[;'vu&Ti ikԶ,_x=B{^Tz^"1+?OԭKӥ6q'| rKU5F)k#t8Ѥo>x0ДGDd椝D/~']SN"u}{_U9g{J ֿ p}7܎~T Ŧu;3C+bn?ɷEc8&)5`;& ?O]<|Ե :nCAߓ7>A'A~te (:Ug/5[.{U42c*Ѫ\{*K'c6Z_s2حW="!iV#b{&8?AGƲxf4]Ic9_۸7*禨ZSR X3ih`׏k +rH tѸh&&ud2 dQ MΡ؏(:i-QRC$I?'I>ֲzdp]~n9vk@ ԐGq _z&Yi}FZ:i*.~ud6`E}}5z`kֺ?B^~׽^GíCQ9#IV(a?ܘux.[Bg@4H ÙByb.Z׵{۽Xj>޼S&J#äL̤q,*ѕ{\קgY"S-*1un,OZygBEׁ ~x߿uǿu&y!`TSg n~m*[ףaQ"}oEae+?op+YMW(ODۜ$CSx!'XĒWoxbuSڧgWvd+ƪ9OPVm#S$8nÐWRzXv,losȽZ E*OxlVN(QDH䷅uKZ9CʱG,Mxh-ҔW~}?4u.ul`(6hYg}6fkNoĀV9zp˸c%B\[?ϳNä Axk[o{鞝(}{^$u$i1D09;̥ DFڟ-B7Ksc(aN)9^<:nk2V3]@IolHJv]#(z2l[Ė "$\{ׇJF= ?Ŭ^Jo V. ' rOXƹ֧ 56ՎUOBmenI/j< yާAܡH5OaTWߕ@^OܟG^T =pzDUX)-M͍n9<JvJ!IKjOet~}mt*|M$X70d%N?N}KT<@Uch&/7ufBkY92wk~}#8 ǠV/*."ʠ}9ȅ1{A$&JnZ%Ob } z=WS ֥y{íSSuUE /r 9-?y%HFeIV'=6~ߖxͅ­S*1kFI}GPl>}??=;pk}PYk\77'4reP^qHR!ϥ~EήR#Gnm$?Fqƽ YjUaGI[~qj 'iҵ f?&@~]F7јl y9Hz$~H>K?A4q7#lkåPAx>[O[ߦfQ{ЧVF㨸)U<HA>[oH[=׺ߔ>u$ut>˸A%E_ߤ'P'ߪG!jӬ8i v:8Mt~{D^A _B?Cs6?Gkb+}w4tPK)"15XsBćX_eH_.L2-Q3pAu!M?=.nOOjfrkѝ㡡#@ _]4=ôӏKnX);{fzf`Bm#WO#{H'}oj^y=J*'m\zpOol?}N4_N:cSCKP~Do<{Nb{m== Q=%Kᅴ" Eyed=qPvݬyf.I _xQN!Y1@f&{8}}<:qPtG έWXy)#0 [d2ޝ(Bmr:ʛ}Ȫ qb=mp yam~2 ts`\tIJ .@<ؓp9>e/*7Q7 {IkߏuaNGs ͒%!f;ߒϹub?K}[toA_C^G3 t@Gm=㫫(n>oۮMn{:ѭҮJEj# rG{oϥ ;b|Τ!~1]V6ovפ]r@cX'Ks#`׏v?J_}punCSfV<#nM2yNcOӣK{qfWnй {A_{mbIԁC1c^-*QFiqnl,>+z.loE3ӑ԰^4,Ԫ sq@ʺ-ץSZ]k7iA})' ~ttWF*A}=/~׽oWu ܂ y?=Ё^IVA)WGÇL++$hu0{]d~{D\[ވ^~_~:fILh׹_u88bi9=B>}vZe*hzKR*(6߽^{u~l`׬3xUoUiJeO $}I-28'H渋^-ݭ%g.}?K/GEG}2:\>է`OìUԩYP18{)դmkNP5#A'H~=[o_}^mF}pK-.k3xF2np}k׮@4C5oxA`qzG~׺?Co>ՔjjuC#($k[ԔRUN-G}ggS3W/l H+o<](d"ޠ6??vd$trGB3N~-m N@T%\~eg\cH?8?R}Hg4@PHV\cY"22[ܴ17?Ѝsͥ][wSتcܘ!jbnl[3L2r=vQeVB*7}ÖH"=Oe4:n\aFS/Pc dۄet9حµZo ZI大ώk#W[m4Ep=f!HFvn *;Oru bG؋޽oN5䪼4anң"OD@S߂eF8[kUaUYfJMrѽt-FdtI +hᡪ5XĤcoϷirl~t =(ψ?.gh)_G V>ERwRmu$O|嫎tIơ;G%v7Bʠ|yZe e{qhcx'{Qnk-Hw+zϯCWV_Inj1^U_ϳt\tmx5V,n^TS,ʢnROwB*45Tͧ5plFr׿7ſZ ]PSMNkkV>4ʅzS^$E~AK~'שKKXMY?{Euj%Z#۷c*p^mAKF3on2 $t!KT^7Yjt ȰE?~>˦Btz>tdqyDI0 u?E ֻ~n§ʸEmb?pgP =ݦ8< 6ͭ+;DϤq{{JtI=ݍGIDId YP #I~{N^1m(xtѴvM4)-DCTG\|6{*`B}?iZjc#8[%!G<U*Oȑt/q^=B<٫}'C(G z>S2X_[toáx8FrL\sb Qnߑ_fjVz"pWѧ}5tGY bly_E9A")I_3_k6JO9L{:&"಑p?#Fn;྽u$-dӪi)N%fiBH՜^5z01.x6}xH]oH=.Ynj:]e7 Ž>?S?lO@`d5cǫ nj!8Q{᠓`5}/늎1 ?$O%D[9B͈k՚EEeNr`n_>Quh`ZǬy_[~x5Ri<9K:C [j1B#]DW] U,6'{WkuvM!S ]j%Uu`uaOϳ!QGv"1PK{>$>^pPQ^b1bqbG~1|Gz|FcCx76e]D}^{fX7QH* :G %51aW҆NjɌ4}Z1?0ss'i2S}Ri?XԞmϷHkҐ! ~s? 7NKT8_^W+$5JbA`ȄZǠ>!(: bBwa(!OĊ͗$`)ۄ5/}Hh[Mʪct~DJRy|R$D>W{UaM l8㎒h$SWBOADe!D ƍmeq"oEN:;nN=Csi[!pzZڢɞ/coL3dž¾]:F,U_xD,>߲1G?ˤ{ԓedtY\jmgHkXb&U_hVH{yuNE)CկVHY*ƒ/E7ӓ‚`Ө;__eo>7ȾZ!WO#y,|bN~j522.G !h[KG"kVϪ{0Y+G/H"r-a%6!H',~6Z Y+Oo˦#ՄIݮWfiMk46E?ldo2L,{?SR< :G$ 7.~.)ѝȅ=eOKIO 31U66zes\qB IEF2yVrE{OvL{{߽u~׸{pty[޸#UŘ^x?K=~#-5)9}}k<[~={!@%$qǡ-r鹿}:a?>HL|AG #MzN%B4{S`zu$GϪWjo@Q߾~mk bHXux(RRۃq&n`OG0簚/-Ti;rdkVAP *hqed.82͉HA{x#>騳SdQ*yYAI#HOdAYg% `;GK-2E$0pbJ}ߛ>ޟ{{ ߺ^ťC}5M:|?ˤ9$ 6#{Lt߿u׺_P,K^y()oieMo$za[KK[MtSSdzO px#Y%2[?qaGOOrsmFovīwO?DVEקet huHOVD2[=GY*>US,R0;gq[qWRn*)83~ڧyG4?<{X@:\3FlbpԔ>U}*H㏧c#2rOU: 9 yuvCH 7RD{p: Kۖ9 4~0S(k{$tފӍ|:gJm[-:RPW@ԯ~ ^#}UBcT~{ҏd^I $bKH}o[R=g@fۚ[zc8ڦUV3Ȱ{/n}9\xUzOb?HQ->` ?OmuǷBK#rZs[_|mo7ӯu}׺Zk\/DtUMM' d1 @Þۮ66~Z~Ge򄊕ЛVO>V\f tӴ*У)+H*@?_j!?s쀃z/:)ιd<]n?IYAa؟p-͹#yכvr W8gb9$/YHВ꤂M}'PèsePv"U*$ 7CK(k{x#~uu+k]u}u|②%{(aCҋi)9.Ȗh(C\N#o>(uYy.IipXhibHJ?ԓOtOD~Ͽu[%%H*l}ԭE:;#j\u ,3΋$2~oۻp&' CIEssp8>.6N3)1Kr=p <=u^?`A?Ak}??޵f]P_.r rǝ$%-ǨrU[T:>n$XBP\FB[ߞ?N?=/|u|?މ^jkآSDVAHB?>0?~^TnEu3[x#&eiҮT$[ Emz׺?޽uី;hrON}AQՙ~.WCWM?q${éFD^okjeܳ(bOGu0_^Tᦚl(^Qcp=h#Hk?Kd724#+ duS#{xwm~2 čHS8E}oi #PK_=ĠVENfu5UF3jqTP}F]o]ũ*4*E,M#.*Mӏr29RkђZWs^ .rs$ ۏqYSo{`=zBQGX(+guB$6:l9 zj8B d }}RWV'#]'7U5 :HyTe-No~^pݻIx4 ׺cJ@5=;@f m~u*MGX蠖N{NM:#hQrIqn?Ǔu *rYl\s`l}Ɋ#k>+QCхBStlfXc~=1~_ņ=8h©5Ÿ Hk$q38$i_X (:.5o}mޚ nɸ$ƠO?Qc#4]GI944\:W|Mݙܮݖ C1ysæZ,9n]VFA9G=vriգ B}0+-`m~}M__ux!bMU/OПȷoƒ}LtK.РnI[*)EZ{lƇtMEZZML+o$NCr>ޛJ t sh~-O4E$.H]1oP o }8fXvypnݠik],~5SJlPkAM%ɭzYcvlK5:"oƟ\kni賡dQ`jZ1o헍$iѕX7%bO[~ak_{FN=Q^Cх-l}E]? xZڸ En |Ah6LXf*uq #P MEovKRdQֻj<{oƫ~-t:!)?z?KSͶ`Ll=LHۢC$gږj tI^4>MÖ\6$C: 7x[ߏorA{qZҋ:%tFwbn9`AI:o fk}PT<%8cջ[Eu܁{DXOۃ#U(pܭ؋oĎ^Oi6co7/@rcVr3jo#>}>H&PGU[CxT_ idf~[{#Kr9'k]cϣnp4l f7 _No!6Wot:\f'9(c¤eHOϷz]:n9_A׺Ɇ_ן{/J4ka'/cvdZ6|x[j ?ݴpKRԶ#_}t-[,h[H/|4 lnH{eOFOQ){GGK)u+F<^ďp\z`{u@Es$+еeF=@r H[}zo_~п^?C{{){kZj:S>$YfA}9=zv<:OJ\PMI7 Y]@굍N&/+%_1]%o!yB ~>1?_7>'=EjGwh*<{#VL>ѧ0-tϥp\BWvokPeؼE17.T}$qW=(j[I]v~'HbGnX~x_ڀЏjWQ 08>|:k@=d[== ?tßeRʦA$T0fR~\ǽ"*.^y$$mvf71Ct{\l?= F:Nh)iꩪԽْ2OJ5׏ϾI:P{kգK)*viY[6߸5*CK{P-Jt7<4؈aH.9`,m8{CHOOu-LEm$ª:L5&_ Dѣv ߁ Z}tgjW=7OKO)˴j-o$!*oM t[՞RWO*Rڔ1f$nx>o0Heϲi+v(URav }c8cqc 9Xُogʲ +rs=YTo|Nx1B 5$Hѩ]H@O{@m=gP=(2_ hcP@S$x"P=n1'-Z5iN]R$<}DGZ.lF \PZƳЯ{SO#fo{ݭo~'=ƾ*a`cSaRW(5WTN\aas,B#RVMXaEO?+ïu:`q?M:\@m$rNM8[Eo(8zsWB(`TyЁZ`t!BRC\tU+%* ?Vp>[LӣG QI:mޢoY.er@B^b!D'?=S֭UL"ůL+ #>{WmG7+f t\I[zJ j:2g rGȫ}%Bh)ۧTN T} 趱\q&AܯH:]d HnGJkܛpH[YSōȷz~yX"G 4D񕍃[>ErF>н cc dҝ|ےRԑa{{Ji{y Qn\3Z~IUBi夂;nHAm)]'{I-ђ硭a!uZ缢qQL k ]Z ~pQ`z;QEY:K2y=~o~gQAϩH&%S_LѥWDrZG=P36Ҏ\JM3D r8Qa35_'"R1@:ܛJEEd_G7?gcU 790S6VՏNp0嚞Y=2j qmՐX$k ZTt1ͭFFkwbf0UȂ?IA{{G?ޮ HgOmA]1UDDE#ږ&}H\ fIYp.Ϭ{{NJ*ѸP;i$mͿ>R5AE s{4si|6ڠ~X^wN_2T+? RGOJvk茋QN]O[9z68Gpi77>ߤ"hNZk X*m噦쎹͈55FKϷ}koa2>+Z/ :*273PeLȂf4Sejf"^}Iʠ6z Z5)z;[e;/Mp,񪩉 ~"I.OC5N;co r]E+.IV+:IyF5J\%8f}*Y~q ױxt=UKb% yYg&Łm~h)ߏ߽<:-Ԟ 衪qnA+CR 8ʸ18GMr>} VA-hV[!+l)^I*I uee4#RXZפglSɏ]r?$0Xq>ןu Hgv1`mcp\K'_I=wm-[E>w_U[8M:ܰlQ/ΣO7ݙcZ='ϫf]eWT%>@5qL)U7?{B.Dp=vyRi7/ryV[E |AQajF({gFSoOC77JX?mO0h3^۬E käkvclj 1S4 :ܷi >}^Z"E;ZNK"%npSzO~=C"i_>vd.E>#%|!?lA+IʶB~/K5jzsw聨t*7U @+-Uŋryϵp=u $kdDP*.IuTA,ָ7r.9 /:uK<\n?{Kkt"mb>y{wgxfhui`{-D=O{;* Ꭺ\U;AI&_xLHKǏOБWTCx2 kZFۅ6@ƶbl8{I=s\G~%hq;%O7}}?^H¨]\ޫáohmHA/LYOo|db8qNZ^I P S5G>ξ4ʳ~cLkX-c=>ťf`F/,pd7{:]qc,Gmv+7NjfmV[,>(PΕ͚-ϯ$މ:t/;MuftZy=%ly\=@8ЌU1op$I)]E{گkF!t[ݯ_O}׾oc~?CGHI׽Xخ=U:y!gM`Y(6iۏ~yӏv:hӧn_`X[{Z}RutB7-"'O.['@@,!u:O+@ ao|=:@&VԁW5;ؒQ8uSL]"E~]ea [@3ǣ m&.}[tr$6,EΪ}{Xb.o:nꎴb&MUP^CM #Uַ{$[ˡmlJ/}c'/!WM XWQ?#ܚ5Br}>>9\_xĸn$E&_Z*U$|Ld:}j4{F8_s/ڑ8v=~EoŁ0 #1{gU `7G(o>$siNGNYMYII7RO*\_Bm~F:,/'pGyKE?ҟzV'baI6}x 7I->';##JFEp۟WT%Q^݉GɈ@mǎG 6?~7S@A\Y2#2/~I!GaxsVHt$tagN}2_XRE67[XK=s\Fco(t̾M#PS-bx6:IF먞^KXxCiއϭܲ(E4O\H9}ߟn%e]G}${5=k{}{{u׺{^{{ND~ܪxܓomyӣ;a%Kto.8BA<ԏ}IOb< s 'Y,Tq6n,EaSpH?͍_݁'(hz'%B, k{{uM{^뫀.(HaL( ''ncқ[gNwv~1A^p/\G2I&_[oC6GAﭥ'xb~K_p?W~O{^a(*m>}(vIIώa뢭fmK=)1\8P'*0?Lؽ5#S ^;>)aKP%xfoԁi}z.* AOZX^r [گNCG$Џ{]d7`H?׺4d{fF KYvFn,Jd.9Ub.xSM?@ZX.YKzWm1S$ YKqg4^=ƧE`^ߕCsNmeYCJ1^pձa!/+1ֶOojHlP~l-׷g ثB꛷m櫭xfsP]U`u~b++$+'!5 _ҴE:6_ޜM0Y=L0S6 bAR?\G1,Iu¥ӈR= ñs^H$&I-n޽<};n$vCfRMC%*&\x_-rI~=u5 zGoR$tM.LtUapMoǶkڟ*z4ZG#A{ԧP)i~}:{u/?xum',BB\liw+}-6>*2qi$ҐR<[*yek/gvM5|E8 7Qaqaoϡ78ao?~=oZߏ>髭OM2A?+bGקU M<$Vl_$+^ӺbWTw2|+ɽ?uz1oꤓԘiՆN8u uKqk@[CSJƒNx| Q*,z}C(꽉ہG 2:=1ƛ ii:5`1TFf 3è=^@ũѩ؛|"yЕ!l7Vێow\ۓ?{r{]f5@q4NzhV}O-> EOꢹ=,exktb&BS3jonO%},J?_v fz_CIMLo b>9 n8VR!!ε?E_߸ BuedtTHAHQ_so_ѦIڮU}y< Uef"q)t[x7m+җf51s8fntɭ~OI<yz%pJр:a5-#b{$z_DDбTSf}7czx)j>]A3J4~64qXiʢEV^=xV30*+זB1~@m۴t+WV ߘ9 o˩mWhoF4p1,a{'SNeC# v] ?R? B=LK7E_ki3 QfI/ЉXӛs" 'OYgv)1"-APsͿĦ:vVziewN2UHX}-x#o t98S$1*(%{6H4/{JgbPyY:B4#$r+=ԕ$r{oӯu!}@8ibJkP hĔNU}AOѿہYR>]jBd/mt/̽ѕ}OF؅#~M`=8X0fՄarO8>AM"_aDҕLzWIW}[j~?K'I?O-$ <CDj[~6߻u^{u}bG9o=_ *8v1+r)tÛmb)II *6"O}V?o!=Mwkeꇩ%7KU%TGOp p蓣~{߀}e]Mya4%P\.m aQKw\U(, -d:m6cm,:U~|XjgWѶ,H8n=}?و&Mz:9:PXiĀ7+BhEϧEG7*sıSuCժs흉.<rhib6v}8ߨ:^չߩ׺uAotaՔjzYBXosTsڑ(2  ӏ{]s Acr9Oz:$p%.X${fϽ~}{\:|IZ}:\ 9s8׺zh|o_.V}C~nI UH}橑tSֹ>}(xdtx<)egpG>aǷ(gտ{pn>@=l GX:*Or9{z~^,[\`t#g[}ԷOn.Gr~X7}>WkrdJow!8p>DÍ!{*4MbG4I9OR:3?O|jbsPI|os-ȠΧuZueJǛ_p Xo=t;`]"߉^D40$̓" Kld)u{2 C#JM5xtXnP-y\UDwO~{߽u~׽޴##F.}xMO^4t_?~k~{{T?<;)=3窍&T1s,<剦n 8DʃgzCJ!-ȸ6ۏl7{3"Q'L*jx8cOP=ֺ[a)LJ^&7&f(헝coo~׺7&}Ԛu+î/_@PY#Rֽ?_Dz{WKH h9.E~y.ýJsQ+K7$?O o=xGR8tc9l]i_{Rn?[U-ìUq 9<O? ׯpNM$}A E"/{Iվ ŽӇ\]ԫ > Q` hxo.PQ\5{/lWOQ!S#\~.?*;Oˣ|pڇE~4h XpXB6o__Ƭ)*.[{~1t&EС=tze*W ,AxyQJWUNOIhBt٘,r$PKR,/kJSK](?CWAN*麠+6'Ԯt)OƃX7﷑N _ںZJ@[$/4*E?Ron bz`CNjJ& $ C~">MzN8db@҅6 J,O϶'hm(Ǡ9Z#rPT\XzoޝC첽BVQ_Nrd+-Ff*(A<SV(-}h7Gפ:7gRomD7n9xfà(ӣssPȖ8C6`ܛ(a?Op*Hn_N 6B@ ?_{:$IO D ,{X1<#H[=p ! }G۟s}4!omɇ+?S_7ds(SR>:?T^tI47Ix ώ0G?܈Ky<[(ƶ3hsUmB| H#W~ hOoolAuOMAG2FWA/oLܠZ'} ӳQxuANI"ČEɵޛGWQjQKzO<ݺRߺ^~{փui Xy}?߆zbx*H b F<m ju^䶷u}ېy׽rE}А8udR惨u@go}9z^~8Et汣[X[S ] qq"-uYwI}D{vठHbCRr@?ؖ+M1Jަx/Rߧor>,Z~,).NvwavSo"rx]EBFidtM;.jgTc#yJ8p"Hլ/?Ocu;icQ>mo gHFOݛ'EJ ۍ+:9?O@6bV4(a<$ao}Ƈ$-ʊ+:LlMWPjpTee^\seՏN+/"bP?Џw鞞Qr{̲ Rx+"89؜IQ+ }=,t6$IS\,J >ԏ~׽x@}v}?}?{ӑ. VbhUsZX^^*hI ʧ0qnv8>|TE :J/c}=ߺY}<, } 3=ĢzcܙMְR$}ŋtYlZN= yjxWGDw||ڵs'Chrs$3nXOŽbOC`+O:coTU$;Ԋ AMJS$?OǷwMq2k:SݟhiC0OK]}avrK??K_{j0PtAI#4+ȮPX%vU<\͚t(OoOtqy} >,{T3uIT8$+-Vj'؍m3jr( 6'T4MO_} jSv<_{ߺ]m~w_~{d-saP:kYaQ7Կ7'}{Tg{^{{>?~P,|}?GVRAC &P鮞k}=u|.u}Ho7=ϭCʉ$o(6-sڋ(mwmBEv(d$<[^עuxM2|M4k_{:Ӱ-rnms{ZE[_KAhQ<Sb)̇ ւBuVھE*FN@̩zsZO>w.TxxQ\#51H-4Cֽ)/=S;hL%<Fb77ԑʛ~Sע%fSUF:zH* ` yqoqmσ:˹][uȒ+j.ykfi'96ޥ]Qҝs3ٻFm 0/="5@>ߏ|j*zur׬S3N8c}?Cu~׿x{{NA?~>۔BGJQdDn:f`j ^ ,THX G<}啻^81ꊷ;9,9 Q(IS ]6?<{Shp:E3'^vvsb"&}>冸l/qjyhkP䱕'GV-=G#ۀmǵ) hqеozՊTVߏcӤ]q{\__|u߾ވ^\kO`(PނI< /}_B[H`oGVIYOuG:@ {>RgC=Tf]_oںq!gBUy)koo|6{Lt7#E>DU\_髟<'tWL:)֙Cny6-K+oҋB tؘؐH rhHAqoOjb{<}=K*x4QUQ`8Гso{A#Rd%]2(ab,w+k?GW2.q|8le<CA'K$XMݠCjrV@:7xd Xݗyk{ҊB0j@Jz?K^=-Y,m}=< 0z_nRZ>N: Wzi) VKϹu*[~-o[y  /!@R|i|^VB)]YE'?Mډvt1N-ϴw&RcK`H%II=y-Fpø1{qt3͖3ON`JR }8+a/ϴrK5ƺvo/; MQV02+J׋_igQV$1 6O* GEJ"O>ۿu-Fs"\:ma{_qer8O z;mէEfulGHXMvts>zC`=s$ FS;pۆZ|"J&Qw<Os5LD~="՞K57v31Ҭp+r/r@ oH#M_cǦEݼN==ks;.=OZZoonia+>6xU""ߩI''F4?SuXϤoх:v8CE%D|AvU${C/{FJ ,4ʩZDG"976` 5t:]>jybgO|c`/?zn/^Z^l_o0ƪ_r>] `58Whn\cdfB9#/oIZOM{bIN_<{09>$m#FoMP4 W Y1kry$ߍ $4NXN^߀oAN8O&RO+W|Pة=m-ZW\1`&v^x+.ۛGq>'KrA#עTTK@ao}*&Kml:B )k7iSId%t#$~SpqY,l {J@a藀ᑞjnf\yAhl@HI}aàGMlȌ T#ߎ^뗾&ǃ+׸8,)7a׺/{׺{^Ћo|kj6GOxӨӦs?5Fbuy_?`)DӴqHơUEk~{{{{ʳ8]O=HOJ~tڴWNZG-`}u}bS5 TN [5pM})+[MGH̺q[p{k-?Qmע}65Sь縩wv1NHXrtsjB؁f5DF1DZ2faHdN=vYI PIQzfVk$*bse x&c!৓Dzl9iBGo34nR#f34^R\"&϶ɼ\7tnbG3i-M ,4 @ey?RO6~=ApԍNuRHX$nTȰ$O4xtmDge24FH )X{gRB{٧e$V+ИfVSQ_ XUk![ۋ>Vx5bUlt[{|2K;_f&x%$ۑv9eԇwv3'B}QT,R+ ]Vp1iqOwn.fi^ Z H&s4wIu3iˣ6 t'ۮ.]MrZ|GI,iLlU?~D1p?$޶Ov2RLפTkd! zx%]p.Aϵ6z)7z ӡϤ?1U<[{kIpm=:'F 6֨R'~ֺ6$@Rjz_ DCjGqs?o~^=yTqӪQ o?[{H/0?=c n+rH>ԨR6X}Tx YXB~3R]>jY~[lxHf@X4GJxjKP-}H$0ߟϴHt$+[M2qo.syoZjtؤUC(=GŽz'FKlUp1c@o^o5,:GHNX[x$u .x⨊)l+\sMNR5?pd !X MBQݻMw^~cgf_yIS{{oȔu6 Zr"G th>%PMZuv%]@*9x #@⍐z ݽ1,wv'ܓT`GV%Q?R5X)d:Z9M)VDku0$6zwq_.뱙ܝ=s?B{m[}^:1*C(?P}9^otziG2*ck>Sŭߏmi>]-=!\&>I#*]#gq4 2ͮ-st$:96 E*6ƯG!I ! jz6qI8ܮ$}J:wQc5uVrQoEu#)f"><4lנGp{qOOU0b|DK>ahK-4-кoӪۆʩ6ŜR9%9ʲe8>C{lʦ^]BU$֎H݈% d<\"j"[8]yu(F;;C{3Y ~Yq$#1u]-go_OfB}ɫ曆q_ So\ 9fO>]ɪF,:!:+h*Q|"Oe[}څE?=z)>ߋ~or?O}rz:AY sMP#pM/) [= ;ʢ7U$BiH)r>k"S=DÁn<6٧PWFkpߦ}~¦J@?'ݭ,aQ[4!~;QV֌F-J%P(ғ.'t / =NJf6} lE,B,tqh@d7X:=pVE%^ p-%v?m c[{Z"LfJLew ƕ>DUrlȽ=fIkۑЍ*:ܗ2.bu*(qGTPpyhyC16IKN==ƞ8Nld2ݪvy9Ј$KRS >K<(, gԞ"UW{7pM-]eI%`V#%ԫ7Ӌ}?3uQ7=/bx&Ԟ]ڹ?j SH#c:,eaa>Mm+N u~Ύ-`Ԥ's BjZ!02r>ӳ6X$koV@KN̼ 6 h(YM/ǿ@]tYZ؀3F*ȪI4=ȷΩ7e)yAA^2ެVf5: 8~or{v9(Gxmw7?apFe?ԛ{5࣠dI3OVQ[(L%Gn4`96u@l&Vpǹ1FHH@*Ey,~O>ɢж9-u_حSfؕ{U*H@k ?|hTt})ΆizffV" gKN yYo?[edxztk&$Ptc9V9t8)>M\\mG\Y?[_{\4qpn&ee88q(t{^ME$bK/}_O#IpH{-0[-K}՟Ae@F,B?O|\e׋n̈xt5פǺD-W@sKK'qb @#xO WǦFh)4+{ OϺ+גÎwvv<׼nlYI{? ]]=.b*8ѝ*-o#pGOE+:x\-$qj<FvPJG'x2y ~E`h5ǺڢA3' U@`%4n }_v0MI%H=$T8C둪:<ܬrIXS7j_\|$,ߛ'ڣ5 (VnXdS"bPRX#)8װ?hRF ơ~輀9{8" ,h*$C ᄒE2㏯iuY|2:h5Ngf;tG*Y( =0!ʁ}/j}}q:c˥eL1Q?;.cmچ }@ Oeb<] ۢSN]U&TDȷH `AUSk6 ŽC ĚG@˨pަ~+i}Cߣw_[ATVNz[tgW g6~ =D2VT2zXۋ/qB8"H5k}xdߔ}~}ԷW zo${݅c=4b-}Y4R_;&qQVT\(`oI'G͍zFONDJuW{qn -OIDRܕ2ZK8W!V+[f%Jbգt6,UK (\/ MIOݥqnJ~?ܬuKJV$`}Gןj*eU[^ $zkJuSϙd$ذk3 ^ߋH?iu2WˣdRq~*X&h}>۟Bc(8?OCgrk7~7zc)xQ`Ώԫ{j+n `: n5q/?+LJ^C\c6i.#xf뜕uMV$.,n}>>)3xe_ q737tV3EI,XT`6qop3_q1qNM)Qm̄v&tlSOSS30ЌA7H>⠲>?_{=" FUYUGH89IoA{U`Ao}^~FANG:fPIW"[<s6Uꤓǧ()ҝB vgߺ]׺ߺ]׺qO~^_Q~ ( gKH~ ݪ͑Їiݚr|=~.5N>*cuPUlAO{57ӛ.y4G`0-7 l}ms?OkCmh$ֽɄɨ*PH7,mb}>ۉbS0ªC}'JxpQ^VHF24?C?ZQ*cby&R?{cC#\}x"A =L:*4]+jZǏ= Ð?7E̼:} 2}IX7}ԁ\tw?_'Io}G+%O';jYl%&J?܅K[y'pSqB(u5=&v>#$D,T }Xy=<5Pp@s{ō9ǻ>y XHK\ }1]VaSZuvkMfj+*"2lCs>ǯ= \h"(tI{oqk{Uo{^{{ߺ^XiՂZi\->Aa>H=zNzTl"6fR,TOOxJTK$Hnxʼnב{<ǩ)eU*8CϺkӒMvJVBinDi͂Es*Ͽ{^{{NS?_[Uf^$w)Esc(OیUE-ohdkHn.:-׮2I4̒K;p86Hohm-'mMq'~ Π8iY{bIPsmogM:pTucۋ`jQWE4 ױ_):MOLK\S&+/IZIH0?ΰ~H{u"]>qOG0X±s#23^fDG)ꪾK~Wr͝C2GN]XpuY X]oU |XVWҰ?Xہ~쎂A8cਇ_l?}=5g-k'&z!ƀ2"($ Ԥs z'1ZNY=JԒ#$}7 }/o#4$O0Yz/|4fEvA!o9 ؞ٕ5Eǥ;RVnڝ'ƯX,{V" k^k_EIt=OG;oGAmޛ~T`D?dqb-=H Mn]@LPg˦6AwrtԘU4R$Tn> do#{zHH#7[vL>6 wZ`(XArf 4cvCgGt43smW>8$Ot֡=r+àR-&i's>ZӢA jD10eҖ*A| GM了utWR.?oshdOo-ʓ5/>G^gDT#Ơ`?U#?{ c;#gKK(0# Hߨ. ԋq}76&#=?UJZIrTLE#J5ՅKٖAԶ}ܔƮ:zyM.XW7xܛ[݇CNPxstV<[/{]du$<8Ss=JIeCʉlaq8Ԣrv=mT- UfSc+Rr$ORʵ:P#mx|fETe (^6>Y Ϳ޽tXfQ,2RUP_smP`ȳV@Ò9{#KsGޡk;eh).PǼ2G g *>bTY ?_`qn!A^~uqxS}{4{]$U ,H5iaQry#6eWrNmPtAxgwSTSaFӮl-~Mz? #Ҵ%Vd"|%T/m>j }-sf=AsLu3};(-*o)Pmxl >GV"ZX O~l}Ao1҈?ƫ_.,A?K4M.[A5Dgwmͷ$Ji[H%Qn{\Zp=[͠q`2l,uӴ* k_<{~efv5-T`4?,VɌN9-nfLZ<{q0_2sԅ*BǧUXLmSʶ`tMrt#؂Jtɸvy|cCX|w}?ŽZ11QVu\-I5Eƹ*%.GKImFKbAèlHz)'O{@$p?{MVHEE{(# u*҇ͱMKƲ~Quߟ?h Z=' ma4f/Ʒ<qk{U1?_jBnΞ= ; mQQB[O?oBX{:^:v\y?קJഒU:F-rqȿ>xOfWKA W^/=O&0&?A'ǎ*)[O'Pn[=-Qȗ kb}\Ƚ@\{*ٜ XSl̸%_YRB-b >z常a8SI78'b 3ǢK뢘Sǣ7כ6 Dm[匒K?Nx_o=B2:$yCkG%X쿋j }˧?O:0i n#|oL\p+#cCQ #IPpE~Icz WI,xH8^am;l=Y2z 77$yET7xLV7Ͽ#=ݫ[J)7-+5;u6n#5m*yb1δeQG('~moi@::<nݟ.:Ysh O? ɱohŋymtOڊbiwMC Imb?<}ESQ}֍CљM~O{]J~{߽u~׺{[:"@M>ƣx8u6ef_RpӒ8^b?{>UϠ̅fdL kkqUIW-,R6FeI'}Pđoz.*Ҟ EMn<n}i [^e*hzOW MNa~ {Ȃ_{j^  fd,FRXoTۃ",OjsK O׃~=Ԟ<:kt(. ؕd5}09H -=Td/g*נ1D:ַ'Qek]UuIHދz#td4N륄}}+7$+J=Q{q EFqXqp)Ke/EK54zmkZl}O?~}zI/v{߽u}#!ӏt*zz932jl2~?rګe?׺t(zi:KIKz HrM H I3rOB:4r<,0FAϵ (/M}sSNCn g~M$e}Q 9ӛOqx/ G_E2PqBmgg`ڙI&_d? ].-LY:6{ugHb }B܏݁I:\{<:^TJA<}Gn}!*|Fj[Ϡ;}=$JpmrNmǵ t]<,k8=?Zu}g~׽ߺ^~{KrOc=YFNTNXϿsr-q{LM]SGQ ?BlE~ֺp~{u?7Ўo <3ҞDP>yI}E0:Qupn{i3h#;6`F^?nt{^Guyg'y䎕Au-B=$wnF4;u!` +^3b>O?_F:Lͭ'-4tt EEQXAߺR}퇽A$uy]r6~}{kՙrzB$ǨN{+j?[NʯV^^boSO4Ki#A+׸dj/;3B% ~Yxx{U?܈T_tn4e2ytiRYikY)Q*Y/ow}Pkz.[?(p\.mCGß[p5=dmǣiS㬥`J.~v龜n?{^@?~x~ߺ]-OJ5tܵ3C"~ rcy/->WJPvKCT­{7r3:M%xte/̺7UٮG3B쏥J9mnpLf6OϡlVIu$J\-T7ѬOn4Z=*n(VJv FK6x%=_]@q'vzTC nĞ{ptXB+K h8~(д8ts/fG=}ϽҲR}ʥ@I}+hBޝm,.˅Ŵ2ƽ )qtiԽe4XCߛ}߶}|]N[ߛ{t ^@ϦRc' rxsc7)Z{}*\oI5ڵ5)'?̼ QJ}cnb~ޤ:za{o6}4ͅ]!ӯ>dtzimSLD:nmbyoԎKg&:AN=E~uOS(a >~X9jHz,?Jtu5svrzMW2<9~׽ߺ^~{߽u} ޿6=:6Q+ioH=1sc}h}';sai!}rmGDjkI AFU~ }}݇ԯr Zq:-چ!Q֦I RExMH>բ}o?`gJH^OA_}*_W:"{ZQIDONp3~6 f6 7kjdp -]=ܧmGz>ٲVg*WL;yD4nA7?{f[3]W[˺8,+#-΢ߎ_p'Ї\e"!CǢo ;(vAZI&[ǭEP_pm_:=*UUTXc׺׺{^Xu~{߽u~׽ߺ^=u45LfX^5s6e#{:yz`V7+$,-4idcŭ;?~f >]VZyDQRvmasY*ZL30 yi$Us0Gp vϷeܛ[ҾM'GP.YZOrhˡ|Gi7 &#?{S|eV*ELS6D~s)Ph>ryhۊnOpdr[ªl-A-0h[߁}ٌyog+!rfTQ`i!@Qao {-5zuR*8сͽAߨ:Y={{o~=xca}jD@ْ2mJ$l>HIH 2ۈ⠍ n@tO{{u׺22DW^#u0d'@T!ISrr4>+щ.tAE?E-RC'IL|q#6}O B)%?_{0ˣ׫Z"68ݰk#$UU(A[Ig=D?ӭKWz1mYE-BTKiZBIŇY*k ~ >H#*)^7+ANmO2a፜4@:~{ }S^xF>~ֺ׺\i$h/xiЋ`{p;qmnݚjz*|rMrQ XoC]6@<$yV@A] 糁)@o걶whoJMuS<~wT8R}*İt z7_cN\Xo&ݢXU_.v{@?QnӢޅ/ycYORTu`p"=_-R 6SǷ*WR}-Dy-ΉGG$hx``.#mRе珨0aPqvx?F4B!HekDҋڽ:V0_qbX"1c"{L72⦓ѭv5q;:pt-6Z]@Hk" !&Y1?bTc< ^Q؋qk /i#}kǍ0}IZ&Z{DYN?86i>ߑXYe W0.v,6THthU֖ھ5Q{ 1!ټԫ)T.?]ћwY%Mث5>UT ێ?׵yY8{6qN:1=ӻyTJ9By iUaztp\$wM;yj;lUd :@_{LB4o]8w+9뭑۰f:QXi j }>#J؃>+jHǷ4^( 1|.Uq))f/a3G$\_ztУh=-+O!)䟣r-{{Ҥ~?<~'*7j`H!x}=nooytBq҇Eio9[ݺS͹b?~~d>h-ss,V=EOJ<%+7smT2ݩ K}:HMI>+A GjHk MeZ%UdtKu^ͬG 97>Sқ[ss&[wXv{CAXP f@U}}u~׺y?Ou pE-i$|l>uK0ut* [5RNOm!#)ǶJdk^̜ XG}V &KP14϶&auIZ㤯ju#MN|gyܛŏݢcZ(M_w!,p|v޵IIHj#K0PZĒ_ot%[Ϲ4.u'ROF{DǠwpsn.c Bάob]df&@@$}./mlY|G ]hPˇT *?]ao}n@q>:z ŚJvJrVKO4F8O7et$#EKvjj, ^!b>}k2hH`KnJͽ,TV?j%8A׺}unؘėfeۄ4q= nfvf=!pDJ,,l ocboS ̩ )*(@uuo,vAU_5e%]dPHJbW++# z'vvG8\$4NXpn˨?\Xǿ 㤵TtiR VM, _nTJ6ŸG~4s>:9؀YW{-\gR@-ۈ4&v45W$g~yovF7[gD1U&B ?pňɿMq뵏~-n-c֝` prB('?}6v:׈VO7hZrjM}%ZpGnk|M$r ɯA>9伎H}`PtI83HXyapub1N#TQt/e=(O׏W?F~ %3ڝ9YETtmTKoG-.z1taM*7"ŵlayj-_ս7aa4faV>v{Y/<d"xGg#.o`V`PE=\#L@H##lᢔ^_ڴ!7DJ SFkhUmCQXS6wBXʪyᎮt ʦCiǹRZK-RL祖kn wjPav5]mpzO(C#j" 4&: _dyZRN3M\q oMāiǢmQ+k cߘ7 91SF#֦ěx:i)~ ~ӡ)S5?Aot%WwS핆_.x.,\ "4yI?EGTzppJ&ǹ:+tmZRMđElǎ=Ǻu^VdkRڀ?${c.l?~dn8SE묞Z \q0%d"6n}T$%JW_@Av龜}ߺ^~{߽u}7oGuEy`=̂UK='imuBW3ޕY+$InlI5KM"IwKvt:llH} 5p8}ӥVmOEt0 Т'55)*MכqʹO#?>814TE'6}~H {P nT.ZL.B+ r-Lgohc%BymMsȉ8\0!B}E[K7$?Z8t$G8᧠#h.YTСJݞ5tek%xbEk?C1AV*IY8tpsVc&=ԝ \n=Hv"يנLV"9aG7Ĉ?_|o6~4zhiԖWU:=*!b=HVWR+ M&ϧRi*ji폼N zbj8;S]ɤԞ2\ǵLt}{OPhE=ͺG>G]mŸ}8_$CTܨ><}}>u1Мs.FODn/92pm'>2雎c1 Ko*,>9$o@`j:Z{`F԰g(z=̶̅LU>7(jUTsdU!vRUnn(V/) \mʖB19 ͘\;^NW|ekǪ*nÏW\~qe'=ՠ[ozN=e{N%nNPo{mD ])`F)ť4u4ͮ2+J ,ےU`,Sz>jjA,$^nʚ"8|҂\]\e]#W7~Zs[Rs)U9 n,ܟprx7.s5)Mdk ?^{Z뿯lĞ'r?޽cAfIS{^tA~{^ C8%A"q=X\6ҽ<0:cxYM5r*ߛo|- [ߚON[ ٸ 5SJ$G6+n>!Ny@odx <-㈏DgpPQTj@M$0GX從Esq,A9<::f T?>ݻ\[QU*5.:{\bP?~=yY\n2η0H } ?x}cRǀI}׻1[CQS)i saCMGK?%Cj6pU۝a[m[`dǨPN?­Ny6{[iFz&ݧH:2[y%L=l;3{0AugcѭXLx_0OO[o{鎟 M)@_h8mj3mǤvcq K;8I0z#P{HCw/KoA:B؃'dKȰF8OLjE-eY0ci{ͅKؤBOG䷋ǗM_o_G!,Ň}I'ǵ ԃtW+o.8W m>´R^hJ!cUG߃i"kI|_ϡW1Vg깷&~xc42-&1{j^=-LdEGjCTT5ʖ$rubOıI =I|HP:Hm雏B&@o kF9" 8cL$)eXůI =%-Jw*yC"PEBq)?'ۏ><3TQ dצ2ZXc I>aR9fT4^Vhz${brP.C6}V-T>!}Q*nVfV:mơ X8&ֿ?xq:U11jա`mc'K?_}CKsa$QsE]⇀&%0xgIjXh)OG%0 -[=\psmgϪ씭9$ KnopM_ oϴFFg@,h$j%->&?=Q~Ŵki/;e&y!zxXi>?O8?؂Bc#mcmy GnmS?q2 t?gͱ"Zno.-{~=\, -:h1uW":04ϸu.Xȶ yƇb4|B]|3QtzTvן϶9ǵu}Ho.v;?E+ @4n vGQE=NQԷx |_{PtK3vWRĠb=ӥ}.'$icxwanӴҊ'S*P5 JkaBªz([_K<:=vb %U"}Fy.@${.?T=&GY$MYQ k&Use2>aNl0i1N=\3cWY\%\j:Mys㶑t;Z=M.40:[ܺhbH'nUS#)yp/#<x**P}96azG1YtK BUeW$(eهALrn}\}pl3ST ^Ƹ)o)DShjkф4o۵4 cn{C=B=!]N}p;.R9?*H$wS(:ZoM7麹(3] 6Q:T$!Sv}bZIrٯM?Ao Dfá{_E'0m, aǼӤU? GJN]Xp5#/l6s J#Lm?=$RdG_lv" HSāfIpnv[uF.ө+uoPǑ"*M7=- uפ=۹jZ|@+r5F}?>#jPâV4>͚ƥLffk5>R:ܓzp^'mƒDVC#q([^,}$)4r^Y$О&-K՚Y*4K:p?o{;\z\(IGVg58\mTOM`A ÝWLtx{z?ߺ]Lm(m]-?i#`r E>Ja%ȸUAGRa0%ga("l#r>ի*:!hѐۻ *4px\o}7Jn0+dv#Y' 0ykFzT]kIlPC~}>WM?{PN:)). ')(wE/ۡEPaZˢ7,_LVAdh% ͔{o {7{ZojxB yi'CohN܏K{wL/eH סN:c^wmv~r=^$i2K6<A_WND+zKot8,YZNY|j.Or((8[X`i5n-րg?yʗ,B]DǟdzT)?9ff^a૰xz::c ϼ>K>bH ܭ4 ;K]dӪ y6#SP@Eb+VF!-EfI=/7ڛfN_?7C-cc%bI4Oڋ B8[۬já7l_agj脍y^MښX!p[kdVlz1A^vڨTTM.UUԣ:'_i%FM8<1/& xr<e+8ᤢY5H>ݣ(. #iК=c/ˢYx'V ;4r-U֗[?kV)q?7ĩe&mGT4aBN7q2FB{AޣQt-4:W)\VI2pݽvnvoe|Ub_ pyࣔ?P_xt["ܡ4cÒbY~TS=ߺ^֝LVzLQk*YX݇xEZmb{a$.08ty50[|_p{==etܓ>kxU?OOoz#jW*5i_ǑsߝxLtӹ3pcG)Dpk_~hYf0~?E~BbO*n8k\mj}Gӣq+a(ǹ&ouhxC6pbRߪ>>_wK~Կ׿={^Xq{{u׺׺߯{}?އϿu{{z^>`ϺC^SJu`I I ޏ:Q Ks'1]XK r~3|>{-0rU=1'[y=̨zvOsk::5%/t fJ%[3H0BpI??Ook z:qF_P>?8`?[}ԐQ==R"^7gquqDe@66#ڢ?-~?~3vu#mqYZ+?f{7 ;jfT&f,OX<Ut :n[t~GUJRSXs>4hߟ{iFzZT"4{v qyrIZ=S,k 04mqi kN}R HLW\$lmoK!xv‹gM %BWj7?p7IT]GK]늪zDqBUCqUFXKnH?l\,Hhs]&ΞXfDb*}ʩtt>ob>۶IcM6z:l P R:<` E3֣ NKlaJ4)/ }G#>֥Qy]SZbCBp/{A?Q-LJ^]S:jVb8t {ۑmBKdu}=ȴC4eˢX:h(^p@k|,H6qc$Q_ƏH~l u&I-L!ΫX}9{5c|y?@xWwGpXit/=LJu3xVN{[+)ݡUzDlLK!KX{##mCSn,ZG>kqA -8Pp,?ܓ>ԯ`+m(,,-yi?rֽX.Zx~-e_y?Z'ks5~K 'yO-`Zη_|=ߤ)7{׺,Aǹ"3,9XˣDGSMHTG ǾU13e~@{4s,1@*QqoQ_Jq* LH{Ԣ9M0/; wSBJra9kΒmv1j9=(ߝJ{O#UNXG(?R ~>K333~O_kPtwiq=z"@ā_"{q񪲚۔Wx=qæ#$ƄJ)?E32yJgaFw}zgWQPT$NqK}BO鱗9#Ráw -3uZ͑I>OܙԅmbT>4ҼiLP,Wb)^_rϜv6 K$m*R5[ۂbozvq3FsäW.6DK!K 6j)}A_ف`: 95ͼMQa#E r@@Ïn=~. qbr'ɍZ_}ā~gݘ$)[!&7%TU'eu_rcBW`B[K,Upofߟ]KݬGﯷ z+VIázDz|}㗂~ }Po=A=nvìxH+efi5\j_?w<:gy#M5e=0e/2kiįzk~@WimsS43xA$p;9}!M\[Mw!6daxWդ`yw*?߰8I^aêt׺MxuA9Xi'o7_rRA?<_%=E`AgcVfHH]DMʠ[LuuEKgY4813x"p![s`/&4]ݏSRbuR[L b? =&jD1ѪPecVAyV?ޥm(OJ6p){r+Cr`h*,.I[Xd؋{'fB % sN8'b秩tL,4|~_gc)$fĐ1{[u߽u|X8ߏ׽0xj-6A-M_,.>:?##Ƨk@sҾeh-6ahzQjzLYUGS>꽭;~`TJđ?F Ic  #4#|>?;E.?'H&0{k[Gb,.l h{n4=ָژ(vU@HUBU$HN}=D~y$gקNYyPn\u#%)Z4oy1F,<ێ?ۈ'x+x$]>|zHm)7V䥫y<eRyx Xw8nnbǪm_!_[w ?Ѓ۞}z*F:!TpkoϷjH~}Of)OC;MIr1o` ;KMWX/A&ov,^0Eer ϣS mm{&&чJ\Vz,AK|}ۦz|~{4])Yˤst Ȳݭ?Wm'=Ɖe>f'aڴO୿%)pO\_߸UϬY/{'u:3 mn-y y~ލ iǠC5"lM8EibӦ\D0#6_8SY' M!n=wnV+8z[#[IN$nj Y)AL5ʶ+^dž\TO-nfi-2xͭ5ttqݫִ,ܰb,O AG"J\{sa=(ڮmSu*=Iq0:3XuIˠ{{;la@cx :}*?hf1A<ǏfKrM+"( rCSJnAԸ'짔jy=)*IҪ fP V^)4ۮKè4ݝjj࣊#<ʞUx8&~nȡDV2*Eߵ'n}uĄ}?g)ԓ$o}~7ǭե4 A2{_[ߒ7 58uuڴ%Fࣧ+ce 1\ ??/(hzy*aIb?^Quk)] 9AM"ȣE}^#FΝvhV{66._=GiZsf& z麯ѹ{責aB~qF_oS8hDzGHirUD?[p Դ7}Ѿc wdv-d]C" ~?}Ue?8K{ĕշXT韩O[Idrķ[~}àGRW~ՊQW e??Ṫ[ӥ-·&r/nR ʒ{REP}k#Hu 0I8g:_p-YYVJzW%P'l~?ignmI+ x/GRuU"I̊Ts׏{!x8tOԖn=A+_# {I9{|8fczrX*UdF=x4rd0\nW#B*,ַ?s؁omx7FΰjO> dtF(Y }HbA/#9P5|uT`X}ߦz{Z#p-n9teՃv@۴{*bXq9 Ho4v^Ϻ$q#mtNŨU6-Hm?oj:3 k侭 }pӏzc=:axXekV#(t> /FtY12+},-~?T@!{/7:z,SjᲕ]u䭫t K(_>j7*ӎ}EF'(# ߳29JKn}}W$_ϣ;K*(CMoxl=03SǥzcPxҢ=ķ qjzWon:FnM;M*f\?~#q3"4è|fQ$eG>OZm>힐t`vbGO|ح>Cӄ1u,u;4_"ztiJ^U0T XϾrSbo;5-[6g'QIA=IzV{o͏{{QR~G@S&{u~_|Te~?*(zn88Sd硬KMR%f_ANͯpcpPP?C.`>9H|.tm&jEhc}; 1q~ї^1nGv:* ffE7&&EYbF'RzoŹiCpWs\J؞kkEt&QnW/4РDu.E5t<~>K{QaijGE4ᎆ;d7 ֕v1T;H,lA,I.ZǓ؄:ݵ9o^ V8@}}W~{{u׺ coǺPu  'x`>C xOzeSEF{^x_Ž<1{^p:PciQ} svN~{G>׺"3cq?DgbY8ԔPĊ q%j( ϡgmawW?'wTⱯR02CpmjQ$1x:<tiӏm)ޢOCW֚[x(#oK{~I2gפ[Nmjb !>:Pd F+i%~#lLu s~o;WR5BOSC8\̃RM܍?k lӣCA X}y_Q{uXq@ոu3$Ziuk<9?_rX?CåB11JM<L棥V9R΄($O2(6 Y# {=TJ}__ͭm#~}:s|@01Pǹ^gĶm{l>6S8{fym#+*eۛzo$p/a"E1g>?{\''o~Al Zө5as,RI^#ca$*:.y}p=Ϸ6{*0PP_`Az VU1Fq؟l=߽ࣥ7 U9XZT *@LFa#sYz]6,jh8*Ox<_:Mҧo}Q:^G2Oןhaox Iây1IjϬe싎ÑLbF@o~I:v! {~+U 1JZxWm} F:'' zUX=B8bIc'O,5sYk77AVrSt?Л{M6`nލ:ڹFԼG]U[M5,<3Inz+Ufk8n}FSJ]:HbiaZ.Fu%{y#a)u*Sy5 d `5Me3޻ߞ}"(=̷ Y3ՇͭԋIJx4UΑ {GL**zw)hYm>QzE׏}`N{:}F:m|T[POށb[p F^*N֩T٬ k>{GM1:CLN""߹}`uRI5=J4 ?gPN{E|}.4)IݣV (Suؕ?\{ō$s}f.u7abX[7yj=8hzlR5iIv鞞OS߂n. C #5P!bzGF@&}Vi^{9TT(&V p}>ntb0cﻁ6~q_{.}y<OB3çB84 2ARn=Gb?uVV=Ka{2HL*3L!$VS =+m]ؓOw^%FBǥVqtmk X{J@o~nnrVKCy,4O֖~G~FǣG!jL>̹3=_Qή?v\}-vS+jF8ӧ7yE~u+0_v<:eC:J(ZV+1 ߤ(H[=^vFzèHu1iKZ8Z5wT]IPq2 {&anzZ }%+6D[~ǻT*TxjV9=nH^,Qي\$rm~R/{Mt~t`>H)XZ{M$r3U Gx]Ny$qnK 6sϸ2.~ǷִER=~K y&k}}n߽u|A AH~<:ڱSQǬTaCfkx[@lō[4'{UO([ߎ}dvCx 506Gl!)ë<)C"@y`K}in>S݉~uŲm{  A\=QUT O5?Ov4=T˩$ 76[n9_zchzhjhE䔻c9E;#O50S vGJWVʼlZي:17W=):z7u:G0C/$Ay_Ė,ysq)ϫ 8}0Ӣ>𢡊=u/{M)!tvUnsrl^֣ZNnװ_|] m,rzj-HU/k YQ@$C{cw(?ǻ`Uj7J!R PKao B`oB}p%rYZ#->r7Zb#lu{n>MEhVTa`HXU헆7:z¿`mO%J@KH}}=͊9$[r?tB</uoos4z2EzoK˂('*25#~ZC^,*yQٔEvJNG뽭='S\~|Eכ;h VGuڌ{p,jM;0մq/j7zaR_j8ƂG?}8tH?#J4*N̲;/ŽH艧YkѡBѨ}>_(YT@|gW,aέ?Qo{o§Js-FУ%MK*.x^xJ ޼So 7I}y:y1lR׸&Oxǿ_,HRz{aj)#8'op sS\ס+KTqck~o}=0hn/ǴLl n}4LƉ%؂PHۏ~jbXn?n =Y>:C($Ȍok!HǼA}__OI*zc9܈b&䋅om`~IuC"i&V/ny| <݈MV8Jps>X}E.귷M=;d|hOOVTTBm {{s5#)iݺ@+t;wn*iE:ǶrM&E8tb2x9Sƪ}j}A&cd+-[w鎟ߺ^~{G׿{ahӣxjxӠg!ú|(ur $~~HNi4Z< N=_o_.I\!y4ؓp>8gHWnGj}BǐGӒ,0QT8 ʟzomtq!NzbLȂRi}LXǸ)m_כ^}TED\$OuO$-f[L @ߟu.PtylmDӫ {_騳}mǷj:+8UG߮n?ߺ$pC6=_??O}. yգ^aY~©)/r[#ښ#KmX&:kJ f]%6hjTͤ&?=Ux[F?~oٴ`ۈKX?Vlj43Tkb=Bhx7yݡ=НU$o\ty_ڦ"h?ԑcenHH'T}1}[غ:&G`L\ݯX[M] [?OK{< n{5ڻ\NyJ0*hzij?TXM\HC6艹kg鍪)A֩qZht_/s9cSԟfT}Û/Y2EQ1DSsFZ$@x73eyj/cz< crEzi,bi YRبЙ98~=q\e0O̎[rJj%QU!sP {~?NIjWˠZ4c`S˜`(Wn/T-o+k/ Om)Nd Xsɽ2{pg gxPѺ!H6=F?K ONHps)&MRb9S+QF[=$^(1pӏ#r x\>+r|z(~]V>JY _~-dQpHIᴖP pG[RؿxI2M#=( Mҋ:a{`e"U'OA3ѬHё>6teכ@-vŭX#W/}㦙#Q_jQx>S~x{&{KO36WVyOXq8j 23(P sP9㋟vHigˤm} xЋGq򄞦"~j s;TyqG˩^JW8֔V'!:C{RD~=nzl-M)NEc@f`oxd@?>܎VHnW t&쭃CWUcp>z9c a)>=Ϳ H:2{xS\VXʚ/ɵ{mP]jtcϏFig*Vo>y?{OyhI^#5 285m)P"M}7ZM.MyCT*q'*z :nJxcr7dtbXaIlx%\AmɃ4sI,MdYO'HPu_ t[kyW [%."ӷQ:ye`8_-( omsFwI.=tdf4Ok+5}}_>GP.Ϩǎ#mW"ݻ UĆiZiw U6="Cb%و:M%_c ~ѨD$bhΛ[\{S@XAos%i^=z+ {5,}fZ L<03z?޽WL4TO5+]ۻhǭ:=7~'ޒKP)f"K}?PÛTk-fGCȌeaϕ[ot[ףi[Xƞ<3 SL^T{)qY]42Jc,j ԌW?>+霠gsQCZTƭQmF~?1%m[:DMMOKH#F4?ESK`A">ϡ%XB.glj\qD>I]FᏪ_~xU$G?~LnF뽓כPnS(_~s" T?&X#tV,f+\,oϼ *_tUr>}(xI;5֢S^P=G}JI?{/1rNz}05\h :~/*\>{`CNRc9u)ޏ:FbV鲅5R0<TGQEF#`s7ݛ4s"bKlu*,Qy]Dca"ppMOoAAäm42+xz_Saˇ}@(kqomVb-n-E MBI+diѢkWeZ>T=([ەCc*+*|t2L\$\<~}RK5OJ!i샎>ܩ<$?K=Ј|=rEö;d$0c3#,_U]d~=˩(}o&(VՠkbJbcCà̭!ez;:jZ(!%Г{T_rbBviҫk׷y{ se>ٓI!H[?׿?{{O#Hjz_PSc'Ul>P{I0l{OiM'xt}5PhGEOo#`lA6_>o5W;^'qkҼ#zK[}Mէo{4 (>}&Ġ2jG)}?^$2XJA}Aﯯ>]3~1]9zq^=K}9ʝz&`k!$}oos \hgOG[ܷ͐EgKKҘfY̚K8u 8:ud)JVE}{ {"[L{hLEGp^B'ʙI 83}Vw{~}wtj6*mW)*EkU*z&rTыؖ:)5V1E6bsßsZtG$Fz0|XeVg. _up աHTfFV~rSZ=<[յ-nx­ Juu͊t]bQ`iᭂF) *V~;=Mk[@ ϣ_6=ߕe}j5I" [XǷ A_OA{Ec $tw]+CHEª>\2K kܿh#G^ZY(I  Hiʭ,F['}]ʲˡ~l AubUe,і8eoMMJ~AsǴ ]u-jv6J*haZ]2:HmpX1k)Nz"nxѭXa1#[M=җ<@g4=˷SztXvsˑ'I*G#:/αTfEto1Uڝwf*;2 -f^os)@=YOG[Cfy1k%"xfTHQ]Xp>_?OtXΠhzi?aoVnI4#eS`8Ǿcֿ_owx-e7dl]hVdVʀX>J]8k[y/ڠ X::&䫨h-CUHضFk~=7pF} N{mVE/+Y# _">5K 5eSM#IXUvdٍxyfL,UT=xC[<2{+{_DX&珥ϼF5?ۉ*9 q;آ.ؕ9Zſzb{ޙuJ/?{7~~Ҿoc~?C߽u}_z lq?n??}=IV^PG?֤%.I[|Hʱk}]ݛ8uކ;>  >;ô0Y29JcV@bQ"LLl>}9 #7Q#b~͔PS|ͮVoSQEb %4 Q׽N{{u`I؜!LjIj(Y@*j:ztxZki$ݤ ^>🧻$i4 p,5:[i'': Ldؘuy$^TV pEi`Xdp><>rn2HZ>O?}Ɔo͏O93= 7%6eٌb1:_}O+HژzL L8&ǐ׸JrױO3c:E/q('aO~ut  ϿTu=uA!zg arɠTH@[ŏ7?_z,ӧDLFMT{]!$HaM`ߑ43IŅ Nٛ%JFslO¨:rC#)DbE+̼:\54zXcT7<y>#8$pO$k*4n.mGh-V?ݩiW9`/<[p-ky7n=!A{w}{{u׺Kױ\~sšh'GϣeǠ~(y>yN@X}mళ0@\l}}BzRxu*` }-{P7K{?y9{G&GNI&Ahz 4bD{_=@AГoϺNF'Q0w6𴜅Ϻ ye:Tt7>3 [,qX>hi Y-hb^v|em<_S!0i [UmLqFO7[$o6 =E7fnTdHQÏ?ҷ_y 9QbNy!U!P4GxMܨEn}ĭ+ط M*zs}aHac?P;O(}:¬]j:*(#1$ UT>jtM,@ ̵ˇGv1Az봫\|:$i6O2i Za1o^Ot=ٕɒ5+17϶nOkqD'&:th ?n}ʥ>ujtɫ&^;(7%fk ȪUC2flF$_? UPZ]J)UWڎ}G^-?^ݡQf[içBkm>Jޝ}r^ʓcvAT{mq(DW&:2[^ zG2׿ԋߟNBIv??O{ud'(A%9Bژ5{lT"MR:J]YJTţ$pOW{:I<RGG`WD$7V5*z3 &;ގLpbEpxuQkOz ]D"HmxO qpz 7WmƦje ڃhC5\L<^ w2H׶]V.)8*J^EK{a\~=N5uytrF)Hv kw:JJVgݚ4,+,5 X?϶%QJoϤ^K Xy?{P:j[emLzy|^}*@U % kёH1ԴĚ_~tkAZ_if&6taݜ6;ArM_ K X_mZ.=.5F(~]+}$k I [iby[\T={F:qmLNP6OǸvyE+ifIFSb>d^XEdٝv;'~08"A֧4P)/lg/[= 8t[ЙB?CJJTW:T) XA4==qGza1qUMg!#-~}%ZAMzפ4=*i玦3uCGBV[?[\tSǨUؚ,Sv ؃{7'݇22zmCˤBVT&1ItU_6{M,h:sT E?NzJo߁m[ U uZ㬓B^k|0ӛ{4Ɖj<:McM Jme0?O{=5ӯuy!a?_t~[l'7c` {i'6@7gIlTM];hhjd(支p(sd!TE{Ue.P= Dp= ܙN{$׹Yoi'?~}$b'V-#~ֺV6V`èR9 "܋[po`MuPT^.} wjԱ} Ed/0F5m /U)ԈY_UVͿ>قp#QƝKqVg#kK /8d:8:O>@dmz—LkO*4} Ϸ[! .`WWOnFQl?6& a,}+PtO%D侢{T߽uAw_0{VȀ2(>ܻ/X/r??ʘo=HP!ɫW[O6Κk}iB)>;ch=3i@tH~nxܖG?=ŦF/Fz 點3z]˭p>FNTD7 !E7k5^cu\]D[c%H=hz)RUj:yѡs{FE{>&F ;Żgh 5[m@id*of .1Uh'e[!l<{sP )\SHE}O鮝@EkÑq[Zu7_ALzyIs驪O{:-noG=ڇM~MF:zuL&ճX,M~=E9cbly{K;5Gl {vv)q*rӘ e*[JcXK=tH6?m:fe!n$>D_ַSHf@aa=їP[t*|: ,o>ߛ?>نmK< <::ia6{* 4J%!-7}/ytCc?߽׺\pmGuycJMLUN$}=zb:5>?@>>tCq&<\Hx? ]'sߪ8ګ1ҹ'ZiCfI?A4mik./ϿTuyx[K;H%7(X=O >sjMGN5UFbu!,G~vw HQq:Xk!%Xc-:;7kZjzVv4 <{oWf_jy$PI]65#f6h f.mOe^ZW`Hj; \w_@N~?^fW }<EH@>;i_q*n.9w鞟}0:o}ZMsҦbOT [|jjL~E>T\\o}y$ӣ?x~qذxXKDO\Cğw3Q0G_m:zt͟|6zDFMasJd`@eN]O=G6 pԆ&[= ^}n6lOoz$׽qq >w'a I-Z_| &KȎ]#[_su/)㋏k,|hNz$޶o&}`!'5‘Z1 &G_m{\=6 _@#<O}^[VV,pEo#n@oTzvIUM[HI䛂x 3oB:v)LMtϙǔ0Ib[?cS[qޕ}:0IeK@G]_豍Z {UGﭿ޽?{[QҦ&@an~ojdB/ak 3.{lB΍ewfퟭr<ѵ@[j'ٕh,}#a[i2h Ž_Bn}}z+ueutcGWMdQK(>l) ㏥[⦳[HX >y-%/j$_}7PGښJz7O zzoϽ^=M4uQn8aovֶ?wJPlF%h%EM'GսOn^oO._eM rӔP'GqjFz3&aPV{{2Z$?޽1h:ǟB.ʉoDץAn=iIV+\:[qx};{ߺ^,gmSץ֓$-V>޸,ooc{Q!~{&wpްlW'U?_Б׺,jA67{O,bCJӣ{ ]/+;7!jR_=~#pܠsЂmQۀ6epE7UFO߆1ftN~SSkqV2IU+h;5k ɺa(\O 87 0՝uOrn |Jf1*^ZE {n}CNoDJHynUVꢬzQI]Ǽ\Lk]#O̟C{ _=?ұlm g_E=+H#f2bq>NW$yۑRӤKlH#nO/LR#Ŏ?{`}2:zލ6䭚»H] iewexQtI7D+e\QZāWjթ#2,l$T{PMҎۛWwBP[~b=%SH 5ƽknO؞cK}?Seߋyqֺr~8kiӑG :mPm,Ѳ݊?, 7?OzzU=z%T/|T}քg*ZT4_O|O~Amծ^d#\i6y7O ai44M_<^BK\'-D|= uFvn=K4mp{L׽{{$_M:XWuL 8[@uyփq"lMX54ZSΟz~,£'r,^A?pc krĂ1[ǣe~ۑwN"j/$Y/>ڒGFytg/F) j `-ہ~=C/'b?ސSW`M ӀpoR&Q7`>}8*w'Xޑ,_ϴRL0:Co4Ӣ7bRlo<n9>JT'{P+O]Bd76-xH`yzYI{J~?{beHH\}jcŖ~lX\xߏ}N!T [u R_ptMcrj^\1a}Cn'/j&x~{߽u~׽ߺ^#^Q,"GOoI]‘t=y~+gUk}?yv mQ@uv æ oKM4tX㧟W4%^@CZJ1qe" ]vkN?o0 ]f jR?H.,XqsKskOoX@/zEW"GMpD,9VM )6ԷۓٟA>E{u{|}ߺ^~{߽u~Ss{.oQcEksssy\ʜbw ߽۪߽u~׽ /#oz"+|=CT pH<ΞG ImW z?Lpm~n )bM Ȇ|a?{B1  :-{<ߗS傇aWF8$Е څm6c}:ؑ`lO":b:0T5WOp76c7W{^ {{ H  &O>:ןY(ArG>(z4PHůGH/m*ϗI|őkJO"_b=t1-e59c1'+R9fӛ5ӷ{^{{<z0P蝤GO|\HO{^=QVf*w^允EH-oMxtp댿MY<УEJſpuX~~sҥMl@"=}kFŇJ!`a̕Ic`(ac[ߞG?P^O| \ CӜ P ǹTΪW<:[c"$_HAU5!m),.}myz>).2:"^%"RuOقb,G?K.dBodFX'#<ѹ!OMkq7_rVMCYj r(e,=徶?_ΐ!A=V#?o.J`ŐʼnIcoɽG}N+ b(&b>P"}IiçcYCyS^j~H7_~"2Xj"0_ɽ~7q<D4 ([uoa׿^׺{{߽`uFXX_w }M:,A*Nn~Xkz]rߪ:O2SHQk߾{5hz2щ?K~_}_׺\^|^^.5qҘmkIhkT.r~ߛ$ipO}pTj$өI $i@O>U$x}7`Ҥr@I~JtJe*8}tSb8{Iqpc`3ЇnےX Y~ިyL52ɮE } xm 8zE=! &(qQSQs(aY2pg LdIN5K0(bXbTaA|?=u_QnH7ooz$U[`RȤ}Z q?p= !(-V/|o,.*#,ƭE{YcR~ DцH]#ɇ)/9oA>jf<^ߛj8Wbkӝ?acfζ'W`}}mtaҗs Q"8S?S,Aԏk[Inj3>'u|c+dT XG68ݶI<:KkbwX]ڹ%c]8 _?>>ቌ۟og@>HɈbxܤ>aUv'ʿBM:J0yͽޔm)ЋmLJVEC\[+%͇z}۟_z5۫%*jbT~e`o۷ !Z/$*ۥfT& nE#_>D5[Gh>xM}=e]~Ye 21E~xSSӥUueQTUÍդRm!P[}mo>`Zk}ܚtcuj#= oA8pFFg-q{m+zΣoۣEرKZhD[qǾQ_=aP4r~d}O};s{=jWfbYTӤ}䣏[ÓJPF!swۛ^ &1ΑTH>m3-ORDvjE1i>[HHQ'n=ֽX>].UM8wv:'?(8_mFfcJܗ,ƏѷPEmFJrO[OI6:T䡅ҫ}{$)``-{XTJQ#5T v5*GЕa$isp8_޴%tJj:HQVcSZier҅I+='Kh,jݿ?Ǿ^ֺ׺{^{{ߺ^%h]/_ïANz?2s'qwKljJN?ҐXq8^J%t3d~=AgP?}` ,lO i>syB$Ā:i8OS<_|= oFk<4Lrdy^`Ccr훀F;[ KAwqn<݋9 h[}(jKi&OwP_R\uc66:HU8eX&^ } $bxCG[STGI [no{M9{d'^ϣƻySTun + cbdEEŏJcemø0ęcL3ц꿕yz-> P~QJ$n?{6UC@ -$}X_v}acR[7NO}N!) 'z.C2Gb$Ck.^}ɸ? tczœ忉N% ޽]_sz'˷6*Ï<)rO-:FaufF!$Luv/O:=<lNoSH~LvԤS\EӢ%>%9k1v"0/mn?-響mU{E>)FBt3Gq#R5oIs^??|{_93I'|N=jD5)5z{RHcp?ouDh"j:^v`4ΕDUpI*-pE􍔩yO2TC񛤊Oo}X^ូysj2ZC=3DUxwn"⒞mԯ;2 f1=-qI}F̤.=+5By#> l0°P)J0.`~OTMXG=5/@[믫դ΃cm<8*t?*?^ v#"^-j)H/n\Bi։0 >2U*}^=Q1q :rkm=Vh-2I&:]V2GBx>d)??OtTmϧͽP3Lܘ͟[حl:ٮ=Fןltxm7_r¸9g#CV;qٸY T8moˎusca?= ęAoc0x1Vzx WxtY4{&Ln)ӿJɺkpNoCFyU'Fj ŇDW+Q+hGP@66$[}I&_S.{-$412@ [~>3L-N=KˠꎏmcWӹA#` k^Ͻ!>I!Y -ookh .ТihM{v=ٵpQK#oV/u9֩5[ڧdjp:#+Ld~_9TcWJ>{I?hG]Kw6s[6x7yQ-vs5;}07|r~}ٺ*[1<"06WOL1`.q$.1Cãc6#qllZ ԴP>ť%mlq~{Zz Ltq~GAX{Iu7B 9z,Ԣ2#:؍_KOI(Q sZ t#!hǢq>S)sGjVF6} _MkHf?YJt}@z8|ۭ.@f v+7/7U6ҥ2MA"HK"2U}tp7U>wA@7-DzsW\#DbWf~:Vu5%]P/5 $~9o!xDBGW3&QIP;}?&'{J۹"gmRUOу?!Mfytϭk[yujE>רS4isœH>ԉ2 8*?_uz}za#^#ܽeOh&iCrWa"+b?pﭺux6P ^@O[[FxtrܐYf}/9%XsYo%_UZG:$ye=@*6[ּ::}[h )PJQj֜[~o5n鷑I1SWnOЛ~}3#ڑJtFjjX#B,_.@<{M SX?ʪYyIRGn، #QcXuT$#ϰ㧉)a}GTɻ6u>ݵqm]dc_R1rmU2 <}ٴD7<;s=?:\y^ QEW5}z?Q8Z ϽSјYTi*C&3ӳ4n1- @+0[Oj'.zP5K5?aZRP}l?)6TYQdAƣa@oJIla_~r.js]Cr??{DcHiHKWE2TPWS!=FÏ"7a ae ~Opr $=9t`(m\ e,uqVtܑQdO${X}:#7r d9z*X䦨NX"siXXاNʒ;hMXm,vҡIGh^F>w6ѥ9OwMCVUjġo:4 П42Qtomny*ي 5')"Y/>j1?#opz7]av5C RڀP~QM:Il'PKm |R$6ԪmϷ(VX msaWYLsp .6H-|X8vͭ0;Ra (2P?ؤ!Vy$͕.6h^CX>;E14JW-q`N[ITc!n96soigeZŭ)>}=t;ƂD-,KX^`l=I,eEk%H%*u%7V$$uVXz>#,GJCWYj?-RL-k\>ĈY15cdN̝VghrU%$'%8Ml1}׽9R8MX jo 9u?xJ\v~ wQ{Z$jjJ.M'(Oq^'J=<Mc:$^/02J_.@??~}jT/B`#T}2Ը԰8Sk lKiS PDёظ %iTI}%[ ~5 @6 @XS&!]MնJ4eczC%MA)~tjE_iK@6E:Gܴ=R1,A`co{5lzI{r;xFOE[+t*쮘;2㩂U1E'G+(pꩵܴ^(mWo EX>ߴ2ؚ\um )o c_>"&u$Ti>]?$HVZH ? jď7:dǑ( ,xW>RBY \nn6X=S?QoAi?}?'qTQm$pf&ͯr#֗Z[H:_o,ޝ܍A)]T0[~*1H ^okq"}/퍴z;}g7ڢ"32-}?N?y&ee] ҍ_I~ؔ;Ldy]?[?ہSk þ+|gO/[ӫ+ԥVֿ}OUN=Ku ͹I۷J|_dU7$p8z+nz6VMSUo7B\G_D?!inj pmJDƖ#amS0mq?qU:%ɠpucֲXT:WW7?5ڿn~.ץ7}߷;_EӾoc~?C߽u}{{~׺osZNz] r~/H^{{{uGu~{o{{ou :bE:$1Jf@C{_ZGu^X{Xq퇆6}dTiM\M>ٴ:nn 1cRGMڛfCu8%~IZ56[sĦ5r :bZ$8=]Wg`7-f?3_OUMFE*l4:JIc=*:H/Ơ ۅO|uLM=zrtJe@KacC"cTSMъ6j_n?s p}NN#;pqcʍ/^O>nqi334=WѫU {jU@<|ޑn 3NB7Zm.2j,W.N!*Iu'_Enҽ#SWw}Ld/Ap9nU/N ,,oi`Uv=_g-nZ`;'. $AFc}4oOV .D8쭑qW:Y++p㦖AuS-ᱸV1^amRc$oa`24LU6+Tc%}ǥ>+Ce6Px,5~9Dj]u]>4C}Gϸs}/ow& 5Je_S,/"~l+p6~z\]L '顈FH#ty F:7XK(@[8)_X b5->ԎtaTHߺ]ϿM\$uT\9 t:cx{&0Bh=Z;T=MU\WVI#k)P"}qjLIz,Lp#]!#}~=[Yꠔ$u%Ⴚ8`J:??_ݏT@QzPN,8iT ~=Qysmb.#}^}?BUH_U4{ǷP^FmܧKMC^ji=hlm`8>d({ >F+0i' !GEia&py[oe2KCX|o\ioƢSTiF&,y ?ZXX!mR]s4)۞}Ȍ큦v| "M&yG_bPcԷr؝lV٦Zjt@B(oH<>UO<}iz6H 8NʋzCaZP٭۾ՎwкИe6 림zr9&֜GPXl$Uedtab=撢I[$q^qp\!ji'IVf#<臘_PR9$zy>#ᱸA<cm-,bS[躹zǹ FTxL=,\w"鄥[<_{DQ V Ûn7F$j4oMߓzY 'ӣ\81 ޾(f<:;cJGS2+#-Ǽyn/`\Q?CqMj))Hcgr [N}ĠAqH֝ -otFw>դM.nE횥N~_p/tLz8J&PP?}smoϷAK$i*p>{=X\CQVհA#k~]F@\ߏ>xueR۞zT=RinXLM#4{ =_O{)SCq{j=dFm^ z6g9Ԡ9*Pc$[= :#hKU?g`%-dV xGw?=޹LN=(%FlHb/{y3͇׃oqU:!?},8 ȔHE=6o7T裑u>X%$c8fDr etgu#"X?쥃E8 Еnm5Id6a!]bJ P E8e6y{A. YpV[dƖ!'S~6=%(zfeR4 ?_ܘ#j{LkHVZ:C ([L{~}Eȏ~z^=7qVyt?4b\IeM /!/#7HY0m$2q{; (0X,7{RBn/?{uGRozOT~˭m 3+ nGurt[=tAmT Ae^`oΥNzj y: 7p=Nzz !=<"h|= ZEP?5\aaȶyqf?^{ea{OzG-j\7MǸJscozע#:::9n-IbF#G=(4\uyPB؏|ykǧHWB\m{]d֯/oϿgu}oq6+*j<4)Q :k}mF͵ZGO۔4qT D $6U;Jb?qkLB%NL "c{8{$@Oz"YX=U,Up3 [q&foz+g#sJcz%+LG㏠ǼѬW@BK01tak!$mstnb=[HG3$  fs㬊6CR&[:1b}}n-{k1N@zѺ&+ *[Ydfǽ Wק%gWIjyIooxnϷ:Mҳ8?m)Рf5W%-36 <UKqCKo0W@(OVR~WO߽{u~է^ ؟z^_<{ɭ802JfhƲoTϼ`1oͭ{4,~}Ny!AT>o"UN,rA颳5M7gU?K/49OZouzUqs)Bxx-7&n1]+/bU[nt]Йu׺p\Cs׺g7?oz{{}{{ur}u<~{*_y?It;@Pcac? ~݁+ ,TtTS:L}UG{^{{ۋ_~<:^y.&M}}z3h|=-ǠpRҷ" \)?Yk :A3/AЁIoMm\43Mgy.s6{{}8̅z*ک 67Ox*!0Hso9>x^ڽtGg($u7 7a߿uF?zn] pC}?nacoe[fBKԈauFKzo"34zXX{jYoHq A˝tl6wUm :`%!PX/uoBPZaM:]}orir.8~"Btk(}z;w)zO v[9O{-ibm+y4t(--NNEwN5HPN i[QiG}IJVOGQ1&I" 7ċO"];{Ju߫׺>6?nT-2E`}#}k>_q#裁nG:y)hT69+ᤋϸY[jop蛙 \z1? v3 /U=Ԍob EC7ًF 07ow==]ϱCrJ% Dm4>]?*^LalE3EP,~ .lǟwΜt)jtoە| >nn}-pߗGR#\ +rac|Ϻ7M?o <~?\~=pꆕS-MH!\8{o#j䠞6$/GyxtVy]&qPSc Jxfx~ǓzEHe>S7}u߾oߺ^mc?OtbqgHJ$-oj}X淑W]1{%_G8im!}ۦ:~z׽ Ϳ׿#ۥ?%4ЃiQ n Y{ ]dW80׻VYO{ w9u3NmBZO!aT}RR+S{v]OYmBjǢ߽6kv6* 1>[.y\CH7?YUm5%::jqt8T"T뷬$āp?[t,BytwqZfT$Ǽw[/o~zc"8u>ȿ_}To`?O~?}Uz)^=z.E{LT?'B+ǥMɞ=!>:d F ~G'o>ioa{g#KY:-1tHN,j~˭[vۍ}K9Arokz-^y_юԘJ_N#HV:F#xj!][}iE-ռ$z^lqЦ/("P%uA{ 5鄏^6;W!(/-$S Z6nT'dBs{ R4&1P-vLo o\I!V}x Kۢ(lϋ3bQ&>K_+>Wc eDW̲xvFg|e,P*hZ(4 }R _]D\;R,5DG]v̪6E+A0K!`<_omƏOLt4WL|%˝8Ssa܎?{M"r?xx~D.VW[;+i -Ei)_<*i)mŅ4^<|9_OmURҧӫo_kҟ qѻ}7\4R7$2MPDc]j #+ǡelmN$tBsfUXݭRaԘuk !m?=U# }>Ru1[t沑ˀ.6 l4H:`kkϸh`~gܣW)D+i> *GӏoNA'G, ױ ]ו ɾ[&k$,Sa夊qYl\n4D'Hx#kop䄳?_?f0FT)Yxˣ%;+nE\n~_l-*g)o^oA66ELֻҒz\z\Ί%O7ڼ0v/F\conlMp^-a>E / PjG-["ЌWdw#,GSUkq0V?;qG#ОƝd'$ 5plW졂 UY-0iFhť K\r#}YAU=!{Ft&FzR y׺:Iן~{?~{߽u~׽ߺ^~{`n er4PUEoPIϾ-v~ySCJaUKE/{}~ԟ~׽4~Oz&]4׻܇iOէSJ㩰k'~ֺ׺'ROz#ϫzn%E?;O_n-:ZX^ `?{O~{߽u}ۃo^֜׭Gr Cϼ xFT7/_lRVGPB{O<}-EzbBպP Xc]' ſj@ 4OS]4y#F6Pj$ -kӛpKN|ɬ.)^Fu}>JLL 64di*9UHSo עF7CYBS&CzocoyB.}ZW~vDsE&NtߏzF=YJP<:7jDA{P7vALtkO^QBX,lIpEA}ܚtV&~yҝ5{Ok׈ SG:kIIlC!W,9[{x0EBq{iߴ*M%MBȇȿB-kO>r>}9` 8֡?}u߾6[ީNǮ?Ev>X=<L9 PV`:OӭI |cXc_J{=\~]<?}oE={~Ohi,h:4 l|yO班DiE`H*@7={^^.=[o[ _>(k'P:mk=jѣE#[|5ժ[ÇH>&hg%p!p @6 GE C?\5B4)XԖJjV#{'*!1=\hV9J)+Ů[{ ؓg=)}tրjL5\5@$p96D;7/so{Gw)uUOG["\z/?'{_n"[H {obOQNow^F(MIVӭ(5jqV ~=cZ dVVWׂ8?6êu)QK16is= =?@?_ȣV _2}9U>"_o|@. {MC^eԎX[y|6=hN:MǁgxIdk*$~2~{oL*u[f)p|YU Po6:qzvKjL* DzH'Y^*VVIuea{1](Lie'i.m}NoMGOdZJuW ^{n%A_ߺ^Eߺ^߿u׺{^LpH}԰aF}2`0H16WI*)k'4SSTE@=۝ϳwrkW̞1 Ԗ7ע΅o={ߺ^(EmUDWIũA[Qů}'ůep:i Yp[2",G_xۦ:PIމ^ycץH#^cQU0O'Bx?v'E'J ZK{A#\bZfr~BoL KqH-kߑ;;ǚ@yw#ķ__"2r &ꑛQlV}}j?S٨#YՈSC=o*mui4ri|XX{[|z'sgZJj:? 5\~Om-E 4Ld'P7cmwVRn%Awk6O=AFߏH$2Iw[ԟǽF锶`dAQGu`vU>*""Ąpm?51MJxgxXE AO|KkxuPj:YX\0T?}hc´|[1zjgd4~ZgVVWsbI?@HXblj{)O PF-1h?$iX*o}/q|zjzJ쌫fUQ~I '}jg|ri(iZ I6[ SW.׳3t~Nf,[_C[=Vc7d$<~VEkRGRNWEѬդE5S7:;3,oٸ9jd$dG?<7[=} ժ6B:LzնXǁk/Ϲ?l57{׈t=n:BS&7'\43JPGOϻ/Hǥ1e}sk(n7/~_{&68Y$G>X~:Rz d5 6_{r=tJ:O4)6L6:>kҢ8$>Oyr{@‡VǤvۣrF5jZK~q9,}MqqƣdФc}̧p][O?/ѕ5i砟q<뢦J1De({8kN}ZLcUB$Xjo67\}=zF)iZ $[6Y_uN.d2i$[<~7ӇÏϿ0 ߁dǮ̒ISk_ۭu߽u~׽ߺ^İ^=u}G"׽ZR)Y..+0tJ] 62Ö> AXJ'~-MҁnH 'ߒVqcyAWE4T3 r qj:b髝>'oSԊ&5]s'E$@ <}}шzYa.;?qx"J=+q{@P u[Wxl3R9*%\Mqx{r)pGnTT-k}?]]h=zk]D^pKK+$`A'{8C/E+zb `U@"ܭ͏2pm{۹<>#{CơJ,_wyGD2 Y.q' B:-U^,d%^ovIzW؟sÏܡL5[8ђ?%: IIG!W_f$X[MGHdfxtT\o;~k[C8 ì9ʩih%&`9OS?}2 zs" C<':ȧ$@c<4Wwjqfb'Ф7\ژ~ -x"!GGWM$,W:T CGp_ПNZ /Bf9M/JBkܪyᗂG{I3i~?gF[&qyt u7ʼJbsiY!? E}s'{1=  b f;35U;h"ljU̯!7<{j1VMzU]G6WU\k̩ifh݈z~\߁OE] ?$>ARqH]VΘkp^=A(t}B$MFY{Sc#<4o.oĒ3$0|aQLdzJxכWyԬISk{^=RFz7u|U.>`)I$6(p/ǿ{4WzIR!v`?6}~AQeJu1JQ6~?[G`oo~qz,ۏzl ?l>6j˯j.Iv-I ~_@t= ؋'E@Ou͉Bk̍f'P r?#XXa{~ ZPI 3Лqnj}fu'WGi胣'3<$[ɿ2+ KgcsL^OďG?{x 8t vFH"j ]@)Mj=$$^xDz~۹ >0#`rr'LڡKsZ׏H4'8+G!M$~?'$p/nx{GEAa>~fy zv$@Fu_[a4ۄT6 M8^LWMO$bM(0: Mq-2y6ڸ^Qa!S!{*rh+^Ճyu{t 7Q6p=+9e?tvxqkq( j>9iIFX'-$_:OhtqFM=_9p7 =u>-o&O1_ƻg|j< ֏8eFښ E,_K5ʮ}c4*Ҋ:Kq!Txhٙې 7<% >܀/{n;Zk5iZS\:O=}/T(CzB>϶T?٥ :: Ac=:<wNni K`OomzGGM)KvfE=5;IR+rYS{8M-ݸPqanYMI]cbh:9 p?Zfow Ho&w:_5"h]=dS^6ҋ9_i$ F{ Mt |'Wۛ hQbV *GH>iX^A[Pֽ mYΐlfJ`,ျ)N} QlAsk[5n{1菇V9"UnOOys۠i]W2Q^G\bRU2Eⶠ(} tHk~ufQm-Dcx\=eH'vF}Oq G/AI m1$W~RiqbkCz 3{4}Z{cq? 3VBA6 V&<}~<X:'KF7דo#2A,.xTbx^OnDϤ[Žu{?sں 2\7 ~?Dx$SbC$2BAaїh3qE%$zmΎwb}MB(GGVzQNvt\=#kib))ozu:}^c(H1(RZͻ%W\8ʙ5qK(P=!X "}l2:7N":00n^{a`/lJϏm_|F%[ ̺# s__stJJ,OJyG' - ?B[د_|d w=Rܻ/h()jS/, jRp:Iۜ.GN {P8tK ?{?zJuH5$f%x| U7l zڈH@NRI%/!G7?Sj+$~?Dt8Kؼ^}cm̤A,T\ǫWIbKoQWnnmrvvhPCB" $Zk{?AΓt}e$eCyy_/^D@ac>,6r>>UkS|TܬeS!Yv̹X*?AZځ}q?{:K\hԦYJSkrrrտ9<0Q3铇A QPO>GӟoQRmyof:m6!;qEKqEˬ+? <vCn>-YVAp'}8zy*YMbYsrx.^/[#+BF詂j)R]d _>CM t"YbE_!2\LdѸ!/ctS"Kn6M>tRM{#xdoG+rm,Ad:v?slIom +sEĺ>}wxa%8E^ÜaQکм:m5$^?n?N=sRe&Oh%2 )s^yӤ{0Z|:B!3OO֟zY?׀,=u׾H/Ԓm@ȣ2Hy٘uMiPO(MN}"9ޠN!p:(1['#T'ݨfyV2/.i K4z']ۃuM,b,{<}}FּzHnŔdZ h[^.n9g'_MbX=G\i#)oܾf0TrMe #6۔3߁ϵע Cˣ1=e*J)eoToGͥdU}"?q1ߔx$9k4";scqT뵬~҂'o4Ns0e+%o.Ajz\xK!Fm6NjPwK[ I<}GMZJN@>׺ZG&[^z~Ͽ׺oo𷹑4j$e34}aU:"@:_qc<{pUH呮f/}Mn2"_n\4cCaRfCE'M?[/tv,ź7EqΆ^{?-.Şh@cc}W}@珯*P1zAՊtⵀV'I4'۽F6|<.0#ۢң?aMB:=ndԾ}=ڹ u$Uܒ-c>udEڵTn}ыD؍BO|L [<}2ū ol~E2VwR~ATT,Z>@tq-Eе4jI#>ݏ+Aл$ 4Fm>W^a?{oX:Pֳ*xIwncbVZI7ˤ)zA\׭9KJfB^Ho,-FnM~(vnl6*}76AT@x<Ѱ`y ˡ+`%r4gT2*W?ri>L@~*5ǫqZ]TItk<{*<~)^ـ:OMps$rX"rO7OzQw6$qb}ׁ,sLVC :,17d??&-hbYOiQ"$~o#!~ǻi3Xj(RnH'<>T$1 #"ʤ~'ox#.>N,^w/DWYd͸}נ\L<%5ӛmm5KeAΣhA{ޫxTtѺRPi2 Eu}ۥ:?ǴWrBJEgm tEC \d=ǽYkkp<1{)d .[Pb x5JÎ]ϣtIvKEiܪѝ&?׏{Zui:Q4juuqo#{>~O8_R:z"řIo߃r&fbR޽˥!I xJEH?\ܚJO5l\-юٵcTg+5[צ.=Ta{=p.Hqѽj uNB,85ag: 2ҝAZַ5T{Q0C)Wqܪab$2\}#ٴma>ӣtRHP}$%T#=K]tJKUWb[,Өq/^nt.y|3K`48:P?-Ǿ( ㋎=ix4INl4M}OS7 6?_UnܯXZ;7>:\6 J ?l=Trs&p~}8gby)VOq㼳hX2oCZKtӁo&#g[i(fXUq ~mӔk$֣'g><,SG$aĊB[n$!@oϴp0q?>7xcEVC?InSbZϤt$q-CDckt>nH襤tU~5\px$܏Ob%syJAՕ쾽ڸjT@A`bZ*OnEX۵PM!c~ETX>\(8SC Q<s(|t#Tt__MU6P3;^7'چh?OytW~}6|*L?UqvM!:eq)R,|OyjiSAb?{nBs_ϥ=#S~m`#^ZGC:^܏vtD8ՙ7v6LtV<x}\/IH EZ܈)%+d'~ؖ8yl6v2+!vur')/7+):Miһݯ#qHNHw[tY `Fkj@Ԗ[HI:CO!!an0лgi伊6 z<٥3#p;w5G^IH,\zGO2Gݿ׹ڳD)㷳C7"X\>c1?ӟ{Mw#_.vK zF:m׷@Uz o@ג;!No!7uXXۙ"fSOVE۟g1 e ǫ. ]Nc b{?=IkQ'DL¼yxL-ltjIG$d j$S oayђBHOHG?z^yfVUG!0{UxgWc޷5s^GJwVp[xA}?GjL:AI[, fX{ʎůzGTV*zrUI }>/wKq~7{P3՞VQCǻg`<߁׷M~{߽u~׽ߺ^~{߽u}X^C;f[~}7K [gIMѳ\~R%xfQEsSUDIҪ$ xxe}. ԻUH+\jTD@I}^bFtCpcV{]I~{~ܚX<^&D=XY}MI?4VP0[\\ DovW>ڵOJ͝w551vtȿ"j:GipވW>r (jTp.ڞ dx6Guw"JBu!mo=:^=͵(d!\xĖҠOǶ9_ 0Vv_ɸ>6M穄<܂uP,-}{{ECZƕacm|Zۋ_9T{zBg{ G>ٹ}WWH:nҖ>U Gݽ`s}IV^.ZLW>kq{9u׺(؏p~CPcl .mʌtn}5\bU`97_q 3_ok-ЯCSbH#~}}S~{{ k9['ޫp:,k/}/p=([IT tX*GOVʤ"i(xAǤjyץ<1$^@x {?RP#8XK;RR:m-,Ut|߻S~eeE8uUO{pm4#_q(=9:*\qo`*y6_!V/q)k-Y(mC~m<tw&UmNf~=ޅ~׽@7s{{?=]de5Xz#eM}u4(H͔[߽u߿{{IW7Oie]'kSk(%#܃QwnfI݇cM_>kÂO7s?_Dd58tNMwUo_c #.Fi|@겣Ƣ?=毂(>۱Ydҽ:GƝ"~1vvߵ 6h-J(gVpWWC-bfN='{rŤ9MwSC*7ұhoISo{T4Z֙x~]=u?-CM']^W[؂${ s~zDKke~97z<[>ǯuom׽[D%z->*9 թ?Q~} iC:u^`I\_ UF! G,.y<9mC@['ϣT8~=ٿzm.~"[}/߂?YI :WODDIEvAmO,ס؉CGM]z.M[ɹZ3r,^%F5aO`Δ VP}=+ss Y; z$no` M[ohiL~:@ 7_۵ aqy/mt..gx tI~L}Kej\T*-ɱ]=K L\>b:Euk~£\z&7Yg-J cq-$:Ϋ5{b`!LJ메1x?}@xQ:\FGYNP~_KFXq.O\`܆G #*L4^ i?^m}z|N%Ilf-*I&+L.ì_>nDHЃiq)uѣ $1REF8?-A\ ϧZ * 4Kr ߋo=0jԃ[5E4{ U4Zep.O:DYx?~mcfh0nS9##ћG775= zQ"0 ybL8ɗ'z@V@ (>ԏ~SDoA`?~țD7+jX.>ʅ/O tF0ad2L%:r:-wSl p; ƪ| $X<}tꐫ/_\Y k\oo0@\tp:cbI6?ޤ* ڴAq9{SWC;_I{mn>TǧX \q馕鄡W66 ݺk}{O^n׽}oaaߏVU,tUUCGvܓp, szr#YB;oӣ{fDt"崓#uL ԟj:#tbяocci}ӀKcOMZ/ry ,i!OMn~&jBlcӏ?Q`IStn`5D1 l+HyV:t\P??~ඤ 0EݯENG]tk-;FPÞl<{$#S={${tF*P*Tr$S珯P}ozju{>5r=uO_Gdu6n}T4K:=D'ָ xo}M'ڐit՛ϟ%1oHIp96NޒN85$}*p-ޔ =u&*Ezs:F"d3xtspEm^]95UP&'v+"q'_o<ktr :8Lp׺(q{N6=u|֝9ۣH5|~~r/~{5龝Go߿Vz끑C$\Ï}^럿{^{{u׺{^{{T7{{^{{u{^ߛ~m{X=s?Wߩת:߅m>׺/~uz^п ^v{86\JOLz">$G<}HƝjVuL..\q7= [?ǏeӼ(4y/At:*,;r 4pK)p&bAojBp[5|׏Cb!hh?JPNVi*NZZur~uA>y?6{uW`}{lF2 %>I$[{4(Rȑ& Ž1-#4YG[]c@/pe A߂.y>AqI(qI(hsUѝFE$r_qE^= 9#A|qx^X Il?ַ6r+x$iJypēp@#Xe-1fBFvrN\^4VXPHkU!eϺ/[@c~ĶI*c>{UNz{{^sMBm}Hh_5kK.sw>?$+ ѡC*qq߾5x_ 0ǗTܶlOp}LŽ+Hs~aOD<-m VJ1zIg6Ux:76ETKGAE,pЂ8E92a⫕UG]OڵjGAD2]33:FYEHf3KN=#W`Qad tU*+*`c1dLĐOm~QJs 7?G۝"}䀘~-~RCCA.>M\lHaN.SXT}>-~GDW [ Lǧ~W>:'\+Dւ";7 [ݺe ?׾Э14:7u5 <]nm[s"[{̠Lŏ'+$m oz._)z.:@ctX {{$FH?~}m d5oX1ӿêjz`?'2_[?_g2b2~G^Cry,SImϵo}1I}yff4UIֽ]ǂI d$vk!X7=R sȱ?b%Ȩ7<9=:XJ*'L^E yRk-ǫ7IjXOR-c='P0:Sm.#_]776p=nmny_{IC1GJ ToQ죑폽~u-~?>#먛 zzH t7Rmahiרi^0 ܁d=)AS%ae#Tu 5;nooZGOǏ`@8q{`:6{0RӠYy RoDIg#u!n. ?R|O7ae+NGx+ *ή=rDz7~B9-V([mH=:$d*z@ԱN`#e }V:j#0P^"p{> zkPo7{wO?utӫPoo}r,x̴5:Z*JxX> ƽu;߁nl>MGQi0? [= \‡(62O$j#VF]u},9!zpW_Pry1u+AQuoϿy/Ja>8=x\<׎ݠԼC+zI?O}c7݈kri~m`9U( ~{ Z&}T׷.8/ooꥉ4&QDzVBr Hz&*:W/teNJu YA"{v7h1KzqUmf6=̚˥PFuRMcm?=&јqk^YXQ"OILeVIcR}si&u4]B'0m [؁>ިm:!Rkح7<|RBk}.~K{ǫ S@8,<|ːyԃVēڃxp8-<'VېyiH[U[L$#7Ң*eZJA{wmvY5ОN`gG6L3z-1X?DcْH[J.$ C8Ss{gӯ@o>M<m!"I-obKtdϤ#v/ '#W+h7~q)kſ[ǿW=lp:=DTV ,O?*;92[Mc$SF60(=9S.3À-%xbB8or%7K\sŽ?We0KHXޢXWOq]gᇗEk= 8mZUiAP~֐-ov|tݣi7N;ʏﰵdE#RT#U_Dzb6M85y>3er/Ϻ2rŵ si'2W٠PJ#5\ gmdž,z# E X\ sEau}@_>kr2ժ"-_Hxo [{qln'4-+mm&zG )mZ >gHtNLtU(y 9]NO/}C"U EG?/yPܟ&-#nUV6Ok_Ie [߁O\KH`i~ع$8玌i%\}=%ʣ?Kbڵf<]K&>) K դj-cb?L0?-C U$  t;1K,k. <T׫I+,V*j 5X_n'+^'KbU \[ߓqǭ+:TSCW Ί4`o)Ư_4L/BeoNN)!X'tG)i],W4lt.oZynu7:on=R?V_>H\{7Pٯs6ꪣtJyؐ:kPGUU m?ٵЕhxܶMKãELk J$(7~m--sWbǧݳjt}ܻzZu(r,E)c @<E OͶ@#(8'~sf?T\;')P{ٲݣ}iU\Vb@aw]I4ku>$s~ߔiTG?Xt:A^]Tj_eoYOQ(2OԃXQoK(U[YП;ynRң:QWE,F-OiEUY <\ؓ=:Rk-zJ_$qAN\YQB8x$(_A{N:bJjZ)^_@ ɽ{-ܨcg+Ðb Wy4<_ܿX=_Ɵ}W>el f|dY Mo𽟟ډTt_e-%!ކ.邴h ?,/ɰ_p23J/_x{Fso[E3<mA$-A#3+3ܻn))F)tMb }IM,6oU$oGRbm]Jh$װol~?kӚu S&xV}y6v~ tz teelC _ˠw](FCt?nzfje@ kڐ6]ZcAȃhkѴMGMfIJ/ T jjZſַIuhǐzv/$F:>ndWB 7* #?}ej?I1#5Y~Y25:CEoao?cۨ_Ϡ0n$j>}CC%t_)R ݿqWom0do-z&ptk 8twNtȊGĂB? *{$z.Bl: ܛwJC/y6gѧUlByhz\ʒؘʬ<2צ&Tg5ʆqYy_[^4s(ǡ}&`Fpo0;B0y"ϲ_NV-m_>wjJ-mXHjk]Ll _?W#)?F`-U6 8g])0ILkG#c#Xͨ({}B7ԢUh=R)TH68h^/fKgs05v,MhkZy`.mqZD; k"#$uZY:'aIk$UYBolBfŌ [ʢX'CVL8!TGy ڮz}~ߏ׏_z˫j4X!S*ߓ\OϽz#bx'J|)P3l3Q y?/?åZZ;|j| ZU^HPA[A^;nͣKTĚ] 4~?sJ$M(nO{j(c+L~}3g˶랮k$VU[q_ڊ%hzaPΥ(:GK<ĂiҨ68}s r.^'lM?i~U+ъz*zW! ɤeB=`_UMz)A7uAFTG2#^1ra6qA-EPe\bD%zA#u/ʯ :9{gnV>w0$tTl UriҠȊ}}?Qq{ ! I`]@(D[ƕzWE),rLh5وѫHSw6#87z#Hiã PSI ?pЃ%Ŏ ~6 צ-:I%[T7q[ǾK9V58oS[MIs| }@?GysGUӴ}EdtY߿ھ| ܕoq}殆P{e4 Oå[ť*e0MWbֱ=k]V }_}}ΣH oOu78-hm6L앋kD,>c,cz_{QNhcYL4߻r~-=8kyµzztfW%~DV1T͛{ƽk%sRFq U |z mkjRO 7}vE>ٽaVB kX~y+U{J2,Otlch|JڞSn m>վoc~?CDo~5{DкWÌ0RhOJ3,b:Ie7!d21n?X sc6>I" `7 yF:J`7-j]R&Riչ^m[8:]dbH*-|4ׇM4=ԯ|Mɰ >I^z*1,O\s"< }?헸<1ktrAE6E~GX2￧Rbkp&kwzVM㥎C$R^'KOydY{Zһ&f)3{b,~cH#l>4/4F=<=ѤX֮i҃i%acmhB ፌkOyhc,Gyz[qK > Kn{0V3?Jm3}y?jYC=A,t=n,.'yay IIYk?})=珩ҋ aG;|dA%|In~yޤ~UIAAMMǡ`q?> =Z s{ߏʤ1x#7[e)o6xB)*#RdѪE?#v'>?>Ze?\t0ɶgY*VWSňK\𷹕1يXܝsKgXA_v~^xUsn n4Om 5캹$,=z$H$EiUt+p쨢P{M:pMƦg+7@[G[wSQzQQ)땼-^.=-s[s<1f5oaߏuVe9s f@C}U7ߨ:^_V`ӬRĒVrMroqz:}edN:`lci}ƫ1/{IR{~^?m:^߿u׺uۋKQ LG#[~]g~~={{ߺ^~{߬?{^a{{u׺X~{߽u~׽ߺ^~{!oϺkPgɪT7q>S:uso>Dd/{FMz~M\0gSAq[6dZqHa *]P%`ӵͿ=@Dai]bQKA0u2ïO,}.cŹ+=>(O#~ʐHkzZkۏ$Jc^HXwYjPu%&]WR 'O-5 ߭| NLݴ@5/4 o#Pä7aW@BFΨk)JIOpo~H tNIcS OCTGholI.>6?xCԘÖP\Ƕ! wB(جV#L\IjI}ȚkWH*BKzopG\}IO>!`HpL}[u;j6)15VmŚ p=6dosr= #A2gݯ_Qt4TGI oqX\,4W-{NXq\xͬ( ɷX3,`oc9=7al\MvJtSMFy㟯rUſېPc=Z\5AQ-[z]LFzOϹ~ao Sq[[wtQvNN1X{PbqǬ-km  CN,?ŹoM$`\\po-2Hk+^ݺF__xRks۟n[7K䋷Jٹm[F5ԩ}Ƥ-OWEiMd9`U,v 9[{RP"GC;I޶=VI ^؎/j<"=UQQ{bIR5/@Pb8NlUYT'Xc,pWۅE:yp?ޏ G*qOٵ٪]mK$bbu]o{t ` qz zo BzeK3$멚~ {+Bk=_1h ! c׷@}!DzBT ǨpDg-Lgf,z\(}}XVw%|-< {{i?A: trGn8 {CƞDt |)S!fb-r 8Co~!~],` R4spҙjGWiz OaYiZcxBsޖ!ٿ<,+7+DQ#QD;/}arVJ B^L{pU]=_=x3F=Aq#^{f L#_G-Ǹmnx~ߵGE8nMK wR1bzY@gP=[6GM  ~>%BOGzt+ŹJ~gbVnjC%ԟ<T\=~[l>gSs[nHKNZBV>Mje҂?a˖$'/oS TݕpijY\0N2 #r:KcKSQMHx{ iמII&o\6yj!!)7?>oWݏ˪ u0`g-a[}~^G!?R1Jf)^qcNnO狀Tt큈[iS*($H}PI? Mta$=;Ư>|c9i#ϵci[$ zshcryIH=ĺ^Є=%)'S(l*!VU_ bqdQ@6[Slj֟~-BSWBN`; 9٨F8Po{m%KsJ"ϧD[m^\F[wlOHXBav I}SUî\I"B-iêtU;׶EVf:we=dTqs}V̮Oٵ-| oi:ty>8 4 Ϫ3X,F?0j$qA[J ½ô2|[^,!!~/om>IƽJmuEWd;93%l .Y s(JPK} ϱDeJ.._z͵0Ac{jQ?-F@ҏ7'ASYL2]AOڎ9y!Q>?\:amN?|u4 T>fi_W#(.w31o^Wbb{o K%$z ~_U{E%RTt6@ޒbܛ!ԑ.y>}RCOuj~@U="Eo.rɩ:2IlJ?_pD_8m}#](9Zgr;$9% $={bjk"T}B?^H>/~׽~^#va;k^=51TzgY}x#T+_m yˤ->;Q)bYQKI}]&Sݩ[:VTP7I)mhy>^徟 uI%iM[M>-JS)P?[m"ě׽u@:UGQRT{cϿuS=KPBÏ~Ju߾u~׽ߺ^~{߽u~׽ߺ^{׺J"N:uHLW$G(<O܄ąq~P yt;oDzFdt{+K ӛƛ27Zg ΣЋIJ(n@{R}@!n4e4MMq @#}O!-WGi bV>Fܘz ISvUO }}(EwR\BxݳA@,ym͉=U&M5"2jobaA@ˠYFz66*4=NT_>跡W/{{ \ ׀$J]k}ͧ[x18ego$cN $+:m"H<1ۉF,?i<:>܀sN^)swCU*Ok2.~>lAco t䎎2qUӇ{^{{R{{u Q_H?I~=kMDRz T5MG'kQ=QzM_JQ6_[z%Mz41Ck,Ћ_oTBBo]uVwmx֩}5(MmoP~MͿOhۄkB?Gdؿ(6mV.P*uD qTcm<ĥzTAwߔ's)*2SYFWen9[S ʮ {~d3)-qͣz8t`m~ĢF(%՜bA"]߿u׺:l?4]M )$ 8_ov:S~<:^q^SOODΟ>A?oGJwOU_Pg沖.c<.d4RP-Ʈ?#kzGy$j=#zZySe'$yPqORqғgp[.:KG6mAB3T,ox9lT_b(hzU#S\9=ƫ7Ňʞۺ:I 5gӟ}HQ*}=Vac'&@D.7O=憵Hqɷ?mA^nbt}'=yc9>IҘ3w=/?XmοJ :dXhP}#q􋏡#QЃ4+:s#{G:$aH#X~I>ߺY}{^7>N`]Ab}Km\xiPLcrbZHe$([m{ov<~@ Tt,O<4MlmҚU s?h OBp>ΊdvehRQyS,uAnB}`$k`>Zz*OGCFwM CX&VAOI7[GJ$}D?}׭)>ptkOߟ?_tcgo;˪N;QLk2VPn {R>OHXHj|[|^VqdoRs{mRN/1 g:05 i82l?^Y_It3۞=q\./bT؀^uo꺆\qGFc/Duu_b6-&.$}ZKKJXVyw׽ׅ:)w.ڛj%-4kiTP{ݺS}3$yy>ͤW:MnMu5s>HF8<ۓ(E;^t2b(OUP#ܭAAL+>Ekmq7~=:mͼGkw<B(u>7?N/ci㄀{dp'`v̍ &v횭%ԇIl5<ǷQPϦLnkY+(`߃'ۭu]-}^<*= 6MZI~}auOM"uE1[Qx_tr,z!VVSN^o6،>M=V> Rd ؟d}G>N:fZcEGÈ%hA$OrڭqǯKo$?]3I:̇Rȱsjl$?}^ߋmp9×TpiY$SYRo2QkTo.:]CuoNo^lJjDeפ,OKߓ?P}Qi@cu!pF4mp ?Ͼޥ_O^Tظ,q=1mB~?Pz ܹ7 {jУCC::XV5<OoRԏ)ᢐ* 6[3u^_$;ng#meC`Ϥ[:^݂7|W_oL^:RȬ6f: ƕ$'~|>Z㏧>2=zgi"[$tlVp*A8G'=<!^6ՆR*:!h_FKp9(@]gu+oV[ÏHXjPvvڭXbsQ7Є>JHs{q#j鯒h4>m2QB P)nK[R|w)=j|XU~Hxqbm7\{(t.fj긩ij+ꢦ;Q&6?cMFH$~?7} #%P.yo4+mR:]mg)IC]N>1}.o?{eGhߛoـ*AA݄_sc9PY[,؋ XMx|F'jJhiVGk->fFqkQB(Q-˵Ħo^fU1k`-KҭYXj^A6K[y=*ԼGILFUhɩ[Xin\axϚC1,H'%"(.p?Ov0\tG[5y\B<-a7S= :GwKz(=/Mي0Ɗ@'1{ ͭn?H#Ct2(d}>9ݺYbOӏމ}X)<:5LPi>Fo~GQ20 >Ͼ?ߺ^ՀߩN׽P ޛơM*Rr/so*c!7sol j=];&mc9 j7NW_be4zvj:iσܓ~o1~x?_o7EQzt3WEhI i?-Y` H? [\$" 3s~ަm]ӈIQqk[D{-X{1F%jàݮK+ٻ0,Kp3q>MF:_2I%VE6?COIrԠ9FUXL,LU:vdXIyI(]ln8}~ڎh5J'.P`T%;gf3:ST,U\8Uo_jxZe?BxZ>Ju>c]Z]|fQeq-uvGO}N`'[A]8|[TOCHsK?_m O>a_:lk Ɋ06opg ہtSu;Lt.- @&Văn}T,/o{ tFtU Lc},6)=M9iِD:Tx=tSIfG{ǛI 6sR:#ˣ;S( iVP? ې~Oǽ=4Xt=DTdԓ!G-oaqSsxɌ0NNܓv=5ӿ:Eק(+QVa?fkGh:P`f)HZKHcn?U]O>ѽWJG GgaŽim0P.}\o١hVTtAsn>ã7w5&z:]Uɸ >xn{{u׺{^{{u׺{^?C"׽QPQxͭ~o`CCVAl]L8?Ϣ]r%jϹ}1+gk۹S?)S]<b߹$^Oq*e:^49<:*v;{kc,~] {to#2in=-<n:g :)jpLpl6Sv-k׎%T- vzIu ȿ{H:Tʂ׷ſ*(:=sȒ7ӞA}mp/WcK~- Gכ_ԑbIWC祶Y6{E&z4J(?œsIq=kAGs l_ve5V>E%5LsI\06 %f ٛ}ˢ,FǣMFˆԴP8~@Ao{qm=8-cAJolC0CquXܟ1%ڼMpPKܱnlz:`r77ˑ+֩0?ǭ_W\KJH7vH ocTtDXtbjjA$ 8W}豱~m^ASC8f0d?B?GOOzsI:;mclvw#QJm(8o:߭͏GG{o١Ek!{שwOבFj> B3\?OjW;[6k9A|]!G:=cPG¡.׽>FWzG h|Zfq59ǣ:9~[_4h5F5qG/$$Eæq:Ir!m.9^JY~?7 .+ϥ."M:Zu (߻56N}~ށ:szV娄(XzM(#vMବWy|>{ r4Mx'ZAP̄ɱPSH#jncubKiP,~Ӏ߷Zh^Y_Ho>n'(zsښz?nv\E5m$uSI{]IbK=F}Eq |=;C4oh.Fo? {ē'?۴,kЭ:A[O8۵#c?S&41t J@9_,5K[#EFRꚀڱxXFc lmŏ{vH3QKZ:L_;WWODJ\cӢt῭턕ʑJtiyc p #=5ܓc2[E?C_m[_o iN=ᆡ!R5iѝqAQ%0\2^9eD(mpoJPc6 ODds}UT b5,O ݌Nu9Uzox2t{{Yw l]=znG٭@ά_'vǿuܶGC\]5.(}svOAz DSڬl}o~׽?P?^9׽Tbl.Gsu'˧'oWꜥ(c4BX:VAe'˥1iCrrS<ǐF>?P''cnS@/J i]O^NԿ~׽`H۟~{X]FmD:W ⱭzFwlW/,{~OښX?#&g^YqodkW;{v-=ߺ^<\OsJԷ R?{% 9?tc9oXNo̠"z-kMꪒ*yXߤ{/koj@AA)$sf_QH?| sp1==I<Oʛ~@ޔ׫c5u2Q6m>:7yu߿{^_ި:^R.OPdtFQ++) i\G]O1DByt1m-oƝWro˜\>&yۙP?}f.n#Fqy{Fo@yh:,I[BӃ(Nx%IGn=Uuxl.Ғfxg8Գ%k(PSmI mZl6_٤&W@dz nQC%-9N[xg0Kx*&ak51%y6'#EqX6Zz0U[ qFҸ8e2t) -eoܒR2/t p=,hYAPvgACP*#<27I{-*OcNw~#Ku͟=DE3 Q?_w}?O#=2:/M"O+ͽ}l'0SEOƪi?0$YA7{G MuAq"k^/`KzAm><דEA^+ƬTSyr3+ s6U#7B_d HY`'0V`lMM\=Ƕ7fFtqol0,uz>}N^]$ y}6'oI&X(B^-Ï8ʌttH UHTjjZc a!IΓpA6QE*},?ۏuTG;p`*eMK )Ǖ1#On%]liå~)i#2 MeGkAZn=ңr|J:UA$O?Cz#>}xI9(t߃?r`f6m\ƣårhzAo[iiQ, Ǽx$}?%4*kx+(wnTA,R}O?^AͿN m 9"[{qX[_t$tofSY9ޕ[C `x#+Pt$(#>(&Mm=;{3OO-Zn6~>TBs\{R1n#ֱkN]kF6hcko@lmHz9-[%o~Rsi-c? `ekvGd: vZtKRX_y 'Aҙv=%qqrC$0#6K $BtoGIIˡL~6㯡pLn,EOӒ 2\5t=Q\aL߿u1?MOKX qyUxxa?w'%EzTdj3LmǼF?OaɌ_0TO?ǼIv' Ez9DL$9NtA8>Ӻ]YNGSBd9@jMŤ TX5G_p܏߷ W4*zqYMy&]5)e#ߤEVM54=jx#[r JpA";A~a>׺@?Qcߟz#N=7ˎI4sވNG+Dڗ6% H$?{+A~x!ф[j@0tO Ee*$,U ?X~_E4IO㩨bU!aU~.٠(::<0˩m??ݩ}8^>_}kS=҄dmD.%4I1*7e1跫F<>AR7H~7?#cn@BA{ c^Tær}v׺i׽@??׽YM?]COۣz`ܵtXlV8HEk\~JںJqmXMZhlom#S갸{Ǡ`OѾbqC3i:5|v%GsdcxSK3ڛMLP@pۦxx}ԃ\ueb4U߁i@5֝R3YL51:e[{KZl?{ 8XGI-u磢1B4ULc(7}= ^$ץq>à׭vF_*bZ{k{VEq4ѓqu&Do??~T=rH4TEUU|ϽukMߺcA玞&f [Fưmd.Q љ>>UaŕJ#4y@cqe\9y&ex>M.=*xh^hJףWεf8TZ1k8 zƚ`5O?!:A[67!A׺zx{p,nB<KlY_# ~p b`K5Ho:},BY+\*i1StKv&B$v2˩nIPIiPȎtnng6ĸ\1r[/~~+^,^ŝ0J]ok_?m= u&ůk[ݺRvA?(\7o8tvBWd_=m{߉R<{ѯ^,NCbSecORZ{uf])p?ͬlLiЗn&)EǢ{%ɾ#-!7?-~\$N>']3 ?oA.lΫF#Dr~=%tri4Ry?<[ `=tO4ȌX=V KPQAr:2XL*RFuo|/~H7ǬDZ$X sB/vKOn/d* W.2)\,*&pmv<϶zn't|8˫ J ^z:KSRHKӑUKX~=/#KirK^nG rTu\9Z@< Ϸ It4醼;[iJ64]D_>> `u-STnV~>ˮkSٹ>*z+Xx  76HUV9[$q^T]q Z`MSfeFPÎoͽM,yΣP Ӡw4Ƕ'mdi H䟯ۥ%8C~>}}\BKX}4z ! ۭ K"9Ɖxkx#j?Ƿ6/>kW=Q>ۗLaBvoM:Ct=zB6 umQ=ScA7OoT, [}q$,лe_#?7Sb}Ŭ&\[,A[KzzZﭨƶ&[ _o^Ht=8er͹W@'H*>02uOv UMGI[pKm|,*`om?U? zv1* IsǥH>&7ur,p:}GϹk:My'=7G:<ڒIwoiK16=t'}î(Y4Hb``YZE+n6:u$"(Cɱ>)#T]Î?#˞_gG60G ׸7^D壝1-# C.kqk SQu+oQ\}}'MpT󪺖mT})mN_~Am*9j>cJ#CK?$Q ɵpА}G0T==kxzOo 2>!IQk[sK L~0IZ}n-dAZ!YPxNCKtEgQJK#GpǴ{*qbߛuj! zo2ץui]mb2Q꩕u:X >t4mt?umY-p(meocsŏئ/+CGX ǻM=[a.@U bI,=ƞPߵʮ*8t_yd@ЫwخБ4ѪjkrGpV?on(LVWTbj\H+P*p??([,u_=i\{41(7 ?xR X J7ǣ- / .=73:L#1nOԎ}KA8-zG"og)w WUwP:m tK,L? $jYMkz>ܕFXq鍾${`ҷsY ~Vchy2}xX8pjO^z2.;wyX`KDCL@|Qv Wո12cBKP&u5`&|mA Pѹ:l & bX$q_Z\Wnt7v4(5ܞ.ooM+ǤT=,ijV5!/?''#_\2E#~t}K> !HRsѳMnzn2e Lۋ_O;+hd_YEhp #Di?س}}2$C zO4FzSqf('k+:E*:<) aǥB,65F`(y=& Ϸʈo6b}[Os,'maoOw:޻,<5UXe[_U?}Ŧn x ԯtWi:0הن-<į Fc@o|ȴ~aڔO]`R%?m\bB)%m?JM?XLt{}p(9b?]mZ; $ OoXpHeg+?Z;dh)koJ,V150Dz!ݜU<:7])k*u*I=`cֹ4_>Qje1!_}?%ӪׁOkuwc`) aōk(JGm?o^4qNpcҠ(~n}㳣p9Ic˧*1:$-dX~ {~NrAK`E: 7/Gl &XA<_qmLPqkF:Gsu-[/ qӤTH Ǿ>n{{Q"OەY~0njyPSB^r=͞u1W{MZ]jz9GO>U{3Ddmpx>t_="v' \ (j;Bݴl-n>ޥFq}6DVWAPt.lŻh`M:}Ӳx棣Y>[4jOVG!$pIǶ.WFV1@4*,r\tZu3-qo}橖0SqmRJ꓏Ko!Ѣ /ZmMܑu @pn[ _n?׿*J1UqTo㚥|t: X/^EBS'K;(?A&|u@bQQR-Ϸ4=}-kCt,Ѷ}?Q}w鴺|_־k>|u$8a?CGӯusy@ß.mwנ{uL;|c;M,oDI[s%S^,qE Ͼu}︝l85ئh>XJ|LhK}:sSԺ*@^:67/>z\]uZ24s 퇵Yxƒ>:Ŗ9~࿐-W}ƖWE @_S+mA⢠'GX}IUIu?^xOMfTQ v 1;%'8GE%G >V+_v.Ѿ")~yFqZheҦ@'.{7:  ǣ|Q" Tߩ`WmNʤO[RY+7?w)KDp?W A[\om:'J7;{H ӾsT>楖$R ?{n-'Y,>އ⢒bʮp~ֺ}{{u:: 7_i ʬ/^b|KOj\s}GC&+6}؁{_{~ԯDdPӣJ$1@oﵿu{{{䑳 \>X@q-A;O2$I?{4>=?N-zv¡k5 .MwHw4#4!F']^X>n-\-mI4{g 4RpA-l ߟo)DjZGy)yKG#ۆ>* =kd t_/|,QqU85,|.%QAt mkmYݽqJpJK?!wWkJNrTߛhgO׺{^\_ߪ:]؟'߮ԏ׺wQ׺{^{{uFOYމTq<͢1SvK+A)K#rŁ׀?Б zV6avJLR S ,?>  >ДHJcxˠy9@dL!o: dpGgAbAN蘰l+yRYY]O->.Ok;Mz(дF>*F%DxߏyK.}ozgUD1&ȩf2]aIUc{kBH?~q^gMф-V*U7#} mDG班5{:?e>'~fkS޽pȷ8n]1D yyAPz͎[Gjb0R,Pd갽=:X}V_uu=zzoCǦ^Ʀ|4NQ^@ o}TU6/<_uLw ]CXv[BTl/cbǸwI<jjz@ ,,{$}??=Ty]J@#n}${ gQ , vϼ7 [g;a*mWHO֤FKIbHl+;){>DB}7 :gW-5S,R{ @}PMϵKqѢiZ&ZF]MhR~Ɩ=9n"qq ͎eJX0 pI ϴgnl- -u#Q%Dyn\,~N߸o#~Eĺ1L7CڔM)|m0A`ӛ}} ǻA#n3)BoGslxEEwT@(#2`ے7X(ѽM- 6@RcpT}-{[}O T}#!uj`lplz7NyI}KxqMju 'פ9[ϵ|eZ5Hxu*7*, uD;+ٕGVʥ6(pOp?QokUX<&utk>?㱹g|%W@9*m[cgthjlRd4Jj<GL VaQ웦yR ;oϼ?By?pzJE ,)V^{ވ^RAǝ:USOҪğݼH<?{F*h= Ƿ GE.v8nNjE-IKuͥY?©jo71.YrI$Oh:4s};ǧmmɨ'z\iC[7̏[-">4 =VU/"俌٭k9?>wg!Yh N#T ";/XnOϷzy#9o%RJ@^ ,.a4=yrID^2I=ᖱ@xnmnGnrzIs,#8gzk TVSS1<[_Ա'/A%O͏AJ:E6ҠZB--0{F 85tK )P.4^׽׽q}u}>Mz DT;-k~G}B@td)MxEb.8'o};3} OϪ=LJTv^G\qo-otn% S/ILInFo:X墤k" ۞?CI(pGZ8*:HK+A :50?i\ hxR %5-\0p{oOzC-h1 Ձlꚼ%U԰o$}O~/K~ׇ>{{uGuu׺ߺ^GH&GߏGsp!|GN_FE; Aj_Q0_Z[}LOFMxu+ߙIWdAk,O\̗R]qxO]l3ؐApOvl@Z=DJyH륱Nǫt5_JP)%K5 au6yR0ҡ?>66$;oCnUC/X*W=<xtL. ~z5fi:^7.HY[TS ܳI%ZDaVOTwVS`1.a@?kU`8c=Y >t/A5*::+y]9 !w@Oc٠!?\~?5i>AOq$kI邷n㫦EҞK18?f.jzu JAq}:RɊu,}Ot$[t YC\tFm qRm+ʟtKkқHBGHCUUY:wB?ڎ7_ۏaGN8&Nj翼ձFqV,tly_+/c1utq.`yEueiV;mRnf=.e"ц/?ƆA)o?wt͹)knߪHRYF܋?4g!5z,; d ͋ 'zX{MgVc˜sqYb5-;:ͳǘfU؆.ǼS8**i[%*0z^iVIL ^F:mK{m%>!ɊtE]+0#\m'l<[2Fz6QlL`%yY\ >+ܠ1 jQbDg]JC-lqH E}XGEsJyoXHAwŞ'O2BOeKOiƻ1bM$ogT tf,ʼnabXQ#@FȠ}tuV2VjCR5M ao=RAގ:DmM?onFǶ٨+ѵ1ȝ.bjD#m-ϸ@X0HnmF:^=ՊQSR=^pHOx?w-=AJY' xݦ!3_wi ̜)”_I{e jۥTJ,1Pdk/v7J~}}u}q"b$GKT׹?_{&&4V+DRe,xVQ?~IUQ_?TSU41T3 ?'}T㞥UQo~/~׽ߺ^֭.?sߏuje:MzQT##XϷy"ϴ;вx ÏDc7q2X&axI8W"< UЂiw1'L% @ s{q}M -kGr$.FJo;)3G'f׊M7Of\z 8h$ ҪHc" PvPnok}n?{Aq#Т#XWkܫ#I+3[=3c+Nk+2Enmckr.T岱_TTdg c=}Rl4% oS{4Y9 {b[%5"vwlGA7[WD"bǤrij~ n QBt~=)^Ɠ" @T**IzXqATyt69EY嗛ܵ6ֽ?_ WP7ѡ.ZιǮB<:']?S׸s7?G?On\Q'ס*/ @ lAbG>:LADiqV-'%0zW!Ez~CMC[yiʄ#y OViHbz?U֣;!&YYVb}N_z?cS~r?}oǽ6Xƣq]XHu fM+d1O#ȲRZ7mDuxQ ^?6[3QHya4FzOXR} {Hq>x{TB KRvvAJ#E,=S{tb3p>o%3yw5[K~fK&NϨcmSt<z^ep֊8Ϣ[U`I =;O _OK2t\qoA~{߽u _Ͽ{^{{u}u|Ukk:~om({:N?eR[{{>8E^ʱ:GeUL25RXk =ڇc [˦--R'sǸ9 -Oi4r2^9<@a E}*P__%{QNm1.1l/{>@BX_߈$ݳ*VtWAq&Ck\~GshbH}}uk>m)zQksOw:Iܘ0`~q3QwVOtQMITZug_oϼ2(Fn-k[IAtWϐ3T.}ۦz{$#ގE:45$}-[SKtڰ,sC=$,"$hHE'cFY꒪2zc˭.=╕#_6R?zeѐѺ}Zp?~>k:@ {娰[t=]P`fI%pG} } [e] ?W覔ib ԊSVMFU@{慠 ;/ߪ:CגECԤT4d%Ao?"W^=IS]wt5UMY!Lc,}dW:%wz^KSPQUxs{=USx[4o'$ɭzn6e!VVM=\Y9FA5}SЛ{zޅb@?x{ϭ`=`Jy4f7*~wƒM-PJ侞UǤn+``RVRDH܈yTX{(!rG  n{NBxz:X*käU_jR$S_p,=9$O?_:.&Й KI(XNm<ue,,VjDupA7Oi7+Mc:\R* OC~O]=m$exufcW PͭTyb݅I OK(cPoyH8{qJy0T m7!j?}Sղ%Ųϓ$/kt+yE,I{WS7{x:Kn&^7T{)P=>^n YH菣 u!Z[uhk9cM ~8hz1cSzJ4#׸aHXyy tŝF) {ss|Xx~=ڔ7"\]ELPXǾף MsUE tfbiy0 Xz |02 8vC)PkDv"{>-CK7?kK*ѡH@u(mw7ſ?+Q^=q{{u y׽P*Y^ޟ/iBp ':ՙ]A%NI1Q-' ?kKv:7޷DN_hfjZ,tKor#{g>ۯ C:DſyU^>V:J-:6Urn.>x{I=**t#T :PH#'~}Lg mkb@YojTYie?)*ϺkɡPtcmU|5q`?_" n@{^럾8_Ct%EOL!9׵}ޣȡNA+v匉λ}m_9X{|r ,tfs'.a:O},?>b"ְ5iq-Hg̵~k{ Zq}EKIؔT \qzL]LL$6 Go;-o=>ȅI_ZQ:6_oy)?½;j5N.`j]*EŮ5)ܧx_mciy`}{g?*ғVQEtO}NOGcUU P,{#̌l4q4m#$bۻ6c3UkLg+k~oC_>U;MAMZQB:v;n5|u#fJZ6D!}(o.8tn Fbͫ\ooq}QWC'{^{{.xCo$t_^I}^}_[W#\sL*u~J _۱!D zEL%%z:n͂zfXPy+b,o~yz.Q~Rub/ſzFu+iӤҏ쏯~ƛy9ZM:1,ݏ/?=?P?m]Y-x֒FuR ^گn1S6)?N~i^=MOLM~} UJL+`EA^/T?l\non?ݢWx>y0çx!NjmbMsqo=PDCѲ:O ,{vM:X\[ϴCMt GEð՞eGQ %t$?#SFS{i^)O )D\~5Zb"VQe'Zxlhn&eã}& ע=ԲQE==+ZBc=MIص7qp{$5~쉦َO!p׷e;sQӠ5ֽ X>-Fc{^=WN'?O";X" ǐy x>QDS8$Pb7s/ꎶ8px]R.I#߾Sx0zR#~=uu,V+_ne 4Ap'K(P E%.y{RӅ!ϲ{KH;|qnvUuUtWdi~[,Qу(٫ 7 kf=mOzے`|'÷+;Oi>S1y(ʄܛ1V* _O$TLWF z*jHшA]y<~s #צL6> mJDJE,PkG3*E@Fەuٹ+ 9P=~O[څ'1$"cAo@{ZP?ɥ`׷]+ )=pH"0mQX/9d}.1G :iZ$}?{M{`TtAM-=cM/צzPq׽ߺ]XA6'Iӑ> fbh~k}GRɬ-k?EWS)Q0xuDMxntq@-k{Gs$SB yE{>PE1F@BĐrb[n?W8t:Nk֟?_=@<:]Yx#^۞9"oI6}=V*QCы .j5luxu=Fzt",ͿͣxX=zHuܴuP%U@'$oȱ[RFUF/ϽԜkVV?1uT7{l8[=ISBA ?ϹVx +g&}O#O ؏nעR~ jW\.Q{y"Vg_ubJ-AӚI$kXQjo2b So\MwEhw{G*ZVyLjO Ϥ-t}_|)_=ЃӱBjJqsq-qz,>Nh{u`TI6=/o{ب7JHc>?>Y0F/ߔ7LdMdr.,Gۂ֩->Zo*WK|4L#<ɱ'9p%Y47@>k ĺItI+ZmQOVԪO~-Gv|}H zҚ#,ȿRaI)[X.KFpzCTv6J2Q{#x^)#eQr=To4&-:Qcw./YDdno|t0/O~:FQR:riZVxe$\y '$-g~h:hVXCr?s?ֿ?OnTtɯJD@H}u߮?ߺzߪ:zuh5}m_(\wѧOl02akJmcgUNHco_icWRudt}u,K< :/{?)$@K.9mlޥ_S~?/,$o8t(ni6ݧGw* rGϹӱ}/4!MOFX1!O|>9DZj[8ބQ4alD%_]H= 2:n=bWwѤK}_O<BMdz+qPG@iK0$|\z? cX:hk#{j'9}?{11@arֽyi0 cs@CåwF8is3hsG߷W'(nAЂwz-g.MT"GTf@wmdH-jɺ)#ZUO o?FcҜ~'DŽ4G:-2}b>H"ǻN3mG-2RBO{H 9={{uv=$hG$rEf1vM}j% YA sl"v`l%|sSTj+$dc l2Ǣ[bRm}t0RdR6 U9}=? =/un^jTdugX,Yn"{AD^\gR&k!3[k{GJYd}DܖXTQD"ډOWڬF1hFhB7\>+{[:m> zq)g Q`E2[~>l31q֗q*VejxpIۜr-eO=|As tGfbs,$ pab= _N?o$@9+}>Za1(bivdWDCO~ B/ͷq|-AA&#MEGFQf&vz=;5괣RerrA&܋B;iQ_[I""dӏB}Ӷvdr)V0ڛȨߛ~?stf:R,hVH%?״EɘM-SϨ})\ wTζO3KJl#* eERI'{؋S$P:HbEU-JP?ַ#2o~ ##DS 6%QኂE6?_U25D",1n^}z ;qu֛+-8]c(KM'Ï#k-15p33ԁNIr؝+solUtxFG 4zV@/=R:m TSOu$. {Ibon 겫gNGz)LJzFVcy[v.oR̴yY%| ?8{MFvR-{>čQӨ|^.mMcVa b9%OaT+>:ia xp7o*GyL@g8xTcDb?KcmiˇD{ojz4;ʺZiv=.5%`?O(?USqoY1>!b~c<y L;T˻ys-CZjZ讀Ƕ|8T2m?oZGˠ0*)X7>ח9m7!EYE2V.+Pz#I5t`pTI#UR@6Bǐn=n8n,ji*)hȑeFSC,}A[e#l*zY,? Z|,h$v j$e_Px?BÇL]5>}*we7ROE\W[8Pg~ro$u$P~ @?o|Ě?^SQґp:2;'!U2(%K!W%@RGQGEz.47Ry {)ѦKDz}.'סm0|ESgA7tǻY_}^G-U+% O7ePqmLc nx"JzҥYbG6 E+B@= M%=ŸyƝjK}GCU:Tm$dc; qΉU{i/ !x?r?zAi2+u+ cߟ|u߽u} {Wu*Yrn.8| 7{O["z)R~Sd7u:u".dEK4P)*m?SoncpP)$$.;7%)!QH౩j%:ҨA? :K ~]V9KUK5d[3d֡oqijͭ#(=x@Nm@zE뿺|H!$V ܜ^lZͬ= F#iɓ1s{:`E%j^+[쀟Nh=8~]TzURyx PX{{HU*d):$a|FۓuB(s"("԰5+X8Ӡ~uC}fr*c5Tu-5?D"]+e]7 t/llbWpCoˢs)#G:n9O;2)+x}o%72&iٮ/"o}V/ǻ@Y3=SsғhNHkUt&.Umc77OX{qX1ЬJbxiRQ {oNz_=mC#Q/[Q!aoI{9U(=JuMj'?&<:TkB'tB^_޼DˮRGI:hkSWB);lM7hzV"KK}OЏ}Z럿{^{{戮Hcaǧ$$9I}m hq 8X}Xt`Z{s|Xy貟y*8d L~[yJ&oЏ zRNzIeJF!\ ͇?#OxspV.7ܟ! q?ץbr#'}ıpl 5W޽&*^XU"{:`xX^ZH[Xq!Zzx\]#gLz&isrHdokx؞,O^1A ([^m`?l}TuD"AfZ8{O´,7KǨͿ{ALJ^ʐ? ͽK3OO^=56lG ?WQǥuPl{]g߿uaJPAX}ZnL7.MO.gEfM%EE'U=ۛT菏FB*P?8߿uu}+p} `R8x*%YF[M͸ۼr{nI!cqٍA墍D 9s"Ӽzʼn'kbC ݮc=MHo7b lD2c˦/mYS/T&s z O3k1G05NX[GT QOS$muX~]Fn-(>^ٕݹԸ<>6FJ z#S"yG_ϹXG[F4W6mΣ\Ӣ jn]\UвC%@*LIe6i׋{9:A:X{Ne>^tU]=/QU* ~@ A&_\BXtvצzAVv^PUK \n+tB{7Nnl7kF ** 3=66QPx\ _˧ۗi#PW^ꫦ۳a/W C-${6;maW{淶ΦnJf˧Nˤ6'+c#2 {zQ "zOdʀrx[r@P{,qǽ)x#INXV#5LuoN?# DzfP#O1ǖ3C} ߪhf5@MKD,4Q.pp2" C"ZMW,U wEWI?SB 1>B8p棤Ki*=,L;QL=6oor4/ʄ_F2ĨXZ qK^2$Y}#<<ӥ~~: ISRj]*y#u1m\dUWXh`:`ڠ~a?^ᡕX?KͽBaT@)fN %LYy!PY-麒mހ0\Xۛ e\BE{PDv'C^j*8({ p$!>}.9<2 x.)ytu6>YTD< `OϾJK}qjQ硊 '8eu'9[^Ñ><:JcjJ|<K[$Q`?D.HԎu!ޑ5^?OϹF?iphoѴ{RKK-5=$@^ 90"ichqX6V*W֏>Â-gM%<9u~?ˢ>}+pH#ܛk-K-,;M<{R,GȖu(z_qЂHꥱpݗ KQ 9_IT?7xaÒ?=4Q̭ǭz,m3$ >=$siqcc[4yPµ2J֢= v @|Wv& GƺA/i4!-oeY$t1m >iwcCn۹l&+ĬBn}&:~?xxZ]pvχ;~y%H6c.#zn䳰e.JWZ5%A_+},#t)[|??zt e+䦩ޚ`l~7E>u$mQQ+SU=` ^{@#?ow2A֑YIBAǿ_WS=态4d{ӥVlWZD/SQ8P voRLփSqm@dg0(T]{kO?>6| s"G/ W zޞer.oi·7BJ)oP폽LutFt\/֡cJʀ?iFa^Ǹ\D= r}guiʲ 7a̓1209]E[_Ut]~x_bHEįBY$&侭^O5H/k\q=!Pzw%S2ENf'G}?Q.->I3ꮷ6;|VGβ"7؀kY?>Z :MV|kݓ֦@Ju^EOonzX ۃϴE}v|GEsj3i(Jh\M}FA;GOE7g7wqK\NVbs9/G՛@12LyIS*o#=\Xq<_z&9iZM3TiN _C+xo+Ǥ)af dۅu߃5BTtwXeSMU,m16yNy[Uq[ϧgNqV9 @Uq?kX Aލ7\'?߽po߽u߾7}~ǽjn:seS"\}:s@ VDBNDj6"~^9Gi=9jYAOP7ll,L1JB C*{v[~?}y?Bk<:'mQQt!ُ?.ZtxH?{P_ozZ7\={{ȑM{0@0sX(Dղ1N .OoN=$R0zrk9aN}`sN# 8co~]PǟKj]q5nKl@>'~}~0:j\#hJ7Į8>?^Aǻ ͸k -(x$RAu$RBߪJd3#?O| o~"6קJDf6$_޴XztF}I7sǐG{UG@ {::uUtQSSPEОaHy)]:@?9{cz+2p?[2> tHv<{NEU?OxݺOҍ I:Eۛsǯuۖ=cu&;4vӢ)i#m+ĥu5OE?[LI7hOM= K+6h؁}B1ǵyz6QFբ> ouߺ^ſx׿ە9ͯ6b?} t}f`Q^caul>㡅eG[%h:[lwD~|{;3UDj]AC(=4m?Jj3{>.y<L[A{{61G}KIV 2}nQ]j@mGUNb=YFo`C/(NzR<`UzK'= 砖wn*\n?@ ƒk=E h:SΥdd AQX~}^EGZW*)jK3 $7Ź{k\-*/Z/Z뗾uAfaϴ ;k#<;R"GV RF4*a,P'x&hO -/>RM[>-e2p{QPXzFS^\'_SOU"bu9)#{ݺ^~{߽uOybӪFM.֚p]H!nx7۔R+oK%ˣiR^^v'#hGO7q2oϻHlgwHnXD%zƿeh}0xkSco)3a۱3[ښjJۂPl_co,+~87ʡP: O;pޡ1qF *]P -~m鎟[ߏޏ^닶fR_C?Tx@ C+S$!?=+.mvs:Q^,?,"kݸbyuƦjy),mᅏ۴Y"eXF yFGfl:u_Sl\tdDv <{pA=_ 0Cz[`ͥA'~OVTgm *zW5S4f~.I?{*(@ߋ:UzRqBILel|hc Uk1QOlEtN/=ڄD̩?K2fHeA=r-{'XhW,\(SXArdtѷtbUt֫ɮRjhu`0\s~O4IFƧSSGOK qPn{+u)c\JǼ7V/kar9,FԔ9>5KX~OHی^[$9LV5.w}v+rF44dD8?[_l51n1tWE11XVeۋ+jfZtj^lPbOt${8[ߺ]D,y]9W.XPUU-~6_q $+z~#4;YYENQFerJtӏ NK4qIP-+ :on+~}8Q񿶏ˣK5OqA.*%qJtH$iK}@GQNڛErefЧG cX<Ԯ('{8yu"ƈh2gf@oc?S($[o#GMrBH9*X.Yְ*)Ch䁧%=íjkA&Ñ[Wߒϻ#->Hq,&h/Q5/}~ ãiObylf&ޠ^ZOu͕@?8& 6}G[!j*dU7,3sz|Wy^AG5PpXe3\5[A}龝=XmVt::HDE>Ϧڇ#-+çnxٵjTdV4 I3b9&x[פNOGFJ`A y8ΓGlB6$ylis:(v=^I$F.@78rG|t~I*$>X-@|icߎ-@]W۫䷈Czv]U9{{{u׺{^{{us׈F_n~xJ9鞻EX #Qb *??}͎\_x$pmx=ƍEڞI<}׎tXgsZ$y*O-ە9dybhz;M3Hc0lͤcv#y6c5\\Zm-(iclJAWqW4!fwS%Ғeܠ?}؊/ǟ?s~~oX- }k{U7&}CZu xj*ad&mr87?>#?SbbŔ.x?{ ;}>h۴K0E\pYop:Qst ڐmcnG~?:4#/e :4oL}'K6'EYYnkjP~=>jOJ  zC[>2sU(vs?[{WFC߽u~)6iӨč-æU]R ił-[kluG é43M4Z[5?Ǿh UkJ$)͐CM-#l/馌uK}}e(Y&0]we`xثikR4=,&P?B=ީ{{\~}k׽I -r/ϺiN)yϕÕdd1Ko}$_v6QN4-41¦SZ?ٹ?Ap?W2ZǤ3Iu: .#AȒEC˒)8(bG>MCa:@?P~>׺8Iި:]_?u@?؋{^?߿ EG[QIhA G{jklōO\i= $aa{~۪#_?NLAc_|^[YnqsG50k)}$H.9$$kXOFm~t [Z}lRʑ`HECMJ'}MsyLBMka^`Gy>]%4BNoE'jh'oX;2t_m=P~4vWAVXcPd_MCE"N&g]oI )r=݁M"׺}N" [/΀= v+Զf \*upX~Wx-1k}oŒ(%]sUO6>C)ȦUk{i^<R[]'FILR_h#omcKSjEчs5^45'Ǿd<~?4VQF#u:ܛX\}!*y7U=:"SQ9lFqNX$s?O]\}IucağϢ=IČ]@Tey*$Jٍvi:~'IEK>:»*(` )zDRK `O#GNpZ(_)>0Eco}xtCIoxح{B<0I=\&V1EE&-"q ЊG,9>)C_{bG;~.2~ؓhQ 5H~96C7q31xtqm j*Ӡ@Unj͌vZi*n6Bu}lFlh5 z I 2 tyNf%Y\,=/ߏ׏{<:ksʎ$B{Eq$ѭbkދvotZ!#9ӫt=ũTf؎>ވ.(z.H+nfʠܐ=.NuHem#ߣ`~ާDRThš1+__Ox95LL?iJ< *gG%}9w& Qu7}~kïF\c%jֺ׺I:V/Uz<;*;*}5&?=K4:Vvt=BәL"%u'ʼǼ&?Q^Au*$u$[Uy" m+??n/e^_9ح<켺# ]1R4jI[skskmrGU{˼{!EK8k9oHKXuT?qP"dX&v'I* ~^{{y8>uUoԪl}cas<׺U^8 }=Mk{G^~"6׽>޽Y@$Z^id"yI}=1KPT]Xk{ K*܏}8nICStail ^ỿNfv  6_}㖊T!]GozKՓW;UM0Jv#yzx+k)2,~,Imىyt0RRa ReWR\GiSOE"qoy`nſqS^,")َ {|?O~(:RcjRZXy"'hfxſޚ0Olړ ӳ12(BRE =KPZɑwEGןarx:8% mWh('s#ȉOr)cP>ѝWEMJ[=r]6?iڏ\㩖2J(YPny*)֣\2زRMn^IK~O(ӎ4;k~=G)TgMomV?OϾ n{Pc%EI`{_nqHZӡ-7Uy;eb*qehbb>2{Pm{fio EAneeu)trNٹJ}UW2U$Jr *u_O{>QJ VZ-%4D. $ozN,Ab:kC,qG(gr->{铃NmqP\_߽uKu>NG齵`.o}ijz"$j*X|u K~{ܤ`om"t<7AN)SQ7:%Ti1#tWU=&uWJrƛ)OkWE,NOXmR H"gŞmdV?,X :Um7`?G> Ǩqu{SVM|f::o=ˢ),Ggjl64Ϡ3vl9rTyRHiwEOAqJHBlmㆰО>7~[p/TRVzeզ1[,u78C^W3OiN6:nWő*#$r n~ZZ >'w#ˤ;mcglulmjA <&Job"9GFco{ioKkkڻhPEu# l=.B' V?ן~?}gfc aLUr[/k>(Ϥ'iP+UGSso1AKE{sJb]W<[j$&KޗKT활AXƨݬȳsI!8#HOؤ6{%;KMD+'#ߩ%`4q_e]'/ ut jl=6`MT kQ֕[Lt 'Yl6pf[(hY׽}[3ǧ-6i&n=0oOx J8'K0aPGyE3,wko0 F}B1[ ϝӉPF.H oǽBFC}!ҫ.;+JvWWIW{ieS. 'ۅFb,mplc:ei8@'T-{׿U# $yu+'J"![#}h:jN"K-:5$ < 7 n̠Бk9A~jji+b528Mi7R.#6d$J܎G~MݺSxt./ou":(cC Ю&yvU$,s~]f$IrSBQ H{epƇ6˙8ϠpEWkԁ/RF~l,m9ҧ=;>s ~!nwnܹ9(䭗OvCe 'R/k#́ևϤ6 o(q\t"IUژ"EaRT86ϰ^ ԝ\ PuI}xj_#2F~ٲRXmRk<~̏jT^V,bbJm֭=1?nQd|5jfTQ=514A_r*f>5&G>] )A3vk\Ldj7_F?WhkЮɭyVI?JSE"0ϐ` 5q夊a`~tN:0U0n==Ÿ'mt^8!ʬ˘Ň/yuj%o>GJ GrYZL~m'QoRX(-/fzgKOA4nD4ԟ 7xA{=X 1>e e2oNLnj7^َtAiTRӅ>7p$?>S? H^)Ntd]}'gP<5XwAH@F&QX/$x+?3!ـE<5vEEc:qEx$Q6j3XcltdږKy$=[ o^ o= ~Nԃ&ÃoOIyk~TqJQ\z?NEX lm}$ (( >KpH1\_g(- @kqo }ʑJEƩUoqJ7S{^C۵'E# iГuFF/_̊\arooT/^BӸ-Ӣ% QNM .ֿojZ 6$N Ndeb( IKnMܩV2M?heU;m*zzڣ?x8CDd{_H `obL}S|)q_իd>6l!RyQCZ+P},OGmr7+/EMn +:M8Vjuzn#U ! up^uu)c /x[ݏL@ g}G~Gӎ}iSãk'j=q DblI G){2JL OG@O:Zs7 ϥ>/lR`MQLJZ/G?e0j[<=^orz |4{n$$}$ }1R:8o}{zS5/<iײ219T#pU0 C5AP}m= {:(JEEZNfTQe՞D|jq2趮??Hh:70c$[$* 4?N=᧮Pm~Oc<:IaF{OUVJk,1B{ۛnBh7'~h΢)L!KY|%nBTCdVDuzEMu1`_[ٵ )ۊ|7ˎk iL*(珯#(/a9ZFעx6ق sT&3 Yr e?o{=(%BVFјWZ"'Zr7W#z"'[&5.UFc':^ 8m~p1 U-IiΖP?NIbJ c,$F)Ѭ7 X~΋g4;*[9"=Į}0W{UǪj7vW;U9mT&0AvRIOˎr* ;p~}!ksT[ opՁd:ZX8=C#+ryǰFUE:RH )zLXHV'$*C!g֋~+9:{T?׫=j GRJpI CA=dj[ןetg0Qfb<$PKOZYffl<85=yHwA*-=DLE}s:7;3E_񹺚lj`IA$,Sq{]:m{II5v[c|kb}hM3-ͬ1G5fys"w뭙|Ml3Kaq,έo=AĞDnUfܣJJ"_CVpMT,C)½ۿw.8Ql#op,-Rln/*,kAçf:la: p#r/5qJ-{EF[B/%V*FG֣: uzOi)!SڙYJ"0aԏȥ GTf)Ir$iǗ:p}okRڅ+Nh<)Փ|Uc$fH.  ^odz6U by"pW6;5E"W1 =5}/h$II t-Cgz'oo|TMIIbM_Gco7 p?KOK>+t : L aH H<Pߏm7tY>]":`cE􃙙nğqΖq SbjE3F(zv.fMVa#`#6<\n=̊Y9N>nn1$R׫9Z8UbEr RΙDqR7[ ~ބz$xqEwۗ6,JccoQGjƠ}=oMH:z$Ry|3G%xRiF:cSGP7-}y"G?t `W=&"SK1aHQ!q{鷞_#~]8`.Vz9čW[M '6Xзni$:"V $b*|C} , vxtG_}lFcXg24d%b[QQ~}q{YNCxpGGoϺi%2\tَÊIde[x ><0<:O<$ķskb.="2yGq>]rJi+YRo|f,`[USN?$4o8%tP?I)]sxt=0|\|ٲѩC"7$rU?[~D>Vluhye^e(QO9c6Χ~>>hԝg p<w̢&wEEKH :2~IARG'~+Љ.#IR'[UG[/I:X{u_tjtb+æ蔳kRʿM[ܒ5OzKP= xtA X k-a`=Ut퇿O^y4+]չ j+u)VM?ʒlms}slٺ=I,Ge[hBYI^,AY\o 6m`t$X&Q㡲s5[Ti#W_b= oٚ!n F뼴N:(s  ϻ= {iu)F{buhkGSLTI_ԯWӆSv?>\q^=HRn ppnw8ܖ-鰑%)XӤ#OԳ%-k=TG}srg3'`ڛFom,lV:hWI۟⹿?x{)$$UUPiPq}sǻW˭ Ono?>\`]TG{n i9g:RމuE~TSf ٷtca*AwV]կ>AhI]ElM۟?kAgv7G. D**X{쪑O~ U<5 Zu>{i?r}ִb39L%bCK&8 ~?3kSh'h2{_~TVkChZubxm~о[Roڝ|uv a-~"nx*`O$OTVCFձepYH_j'G #A|f @|n}(++9sH7[8NJbeu]olnxή#0m_+3mŐ $iLNX ),~۽t{umMu~Uy o^>h+^9$4tݒ2SOjR-ȹ|*9PTAIf=U[L[7HկDt3HPTouba=*@<nCǿNͨ׬"H{_o߅$=ҹT4]ףȞCƛA=u/~{7:}#EinF1)24P!5`Wַ 5KVW6[ޫN={]*)f`9$=c\ʒGLsgiBA Hܐx{ofcv&:WA Ǯ9RL/Cs`8ǷJ!3=O,y?u)ɳi#*i ks#=CvaJ΃eo(7:JERJZvMiv[%Pm4 o{!Yy>^aH2Eex>7J}xRj:. *KM,6qeOoSDr?K<[mDy.6:y6dWqomu l}Btzxtk6,ua(+پxH GI_|V>>ہ++SӽNZh0 ~ {`׷cziIdy?^W>{{u׺ ð@ IEbqqϾ?Nn~=LkhKM+o:pI&(O:n΍Ex"WǴT1dmH/*6\1$۟;ttSmm!!PMz0{:\vN*|$T (X{8Q՚ro?Ƿ.m \GIҿ:S۔El14'A)dv2}L<e; 1ӫ\!5ͱh+tO+{jcvV xsR_jn\}z^;}@ԘMTE{zAa@>ΞzZq2$TY]3}R{BW!w$kbG1A =0$\SeS>4R@@H# 9 i$,8tv Z[ˢU:gm3MGmEY~G[+Cw4B<~ؤEDVasv;ROOݔgO,Knzu\&_s[Y7l΍ǣmX%1)xLBL6Hٗxu1Z/~Io Oe*ZlZ, IPJ7ZoԛGӏW:)jʨ{Xt=d)>RĎHܟ>4H,>1w to%QASLt v[74X \QnoojA58=LT蒯(ժž’I7H5/ts6I_4!FXEŀ{Vkߟ6m~˭nu+s 4$6 oŭRHDh:b~O~}̊$~?Ӽѡk,tn>a2 DjciYoCq=93,[KtwSTEAOTe"k_)?EB " >Gl|U>{A=ꢵLH$2k&ZY/9~='?~jS+U]Hd6 oy!7R/>8?op8_9au*VDQ{qLoKj@TPy+vI[v;.8EDRyt<6m?qsq@PE$Qǡkүa_ی~?M?>:,V+Hp @M}-F0ߛ}GmsOǵ%lwVG?Kz=e-qr{Jxݝp!-._pM%gLj _jVG[>HjHsmKuQX>=ujjd inm5V="ScO$qomxg:XSGh[eU%]9XPu+{ͤ*}^:~ß{M8$_~={0V[0O0Zdž??in[0I@mtd1+@ZV.mc~G-}7no~EqNtM⺪ao77~뵜6H"BDccU iLNԸȩe2 _~>}{Yӧ`u@߅Acq'{ThhZߑ/@EK-"̣ SXIaZjᅇ&:`SV|>: 2=3A@Z$Gb $82daҙL J-i 5&lߋmEzJJuz]u-r}#~}K{_߿N(\0cu 1 T [+'XdjI^ipԐK(~`})5$  1vCMCKOF"?5:2)_ޱ,~UD̺aR|7: )QYdQҤ1:jPnM}钋ز-+6F/ 1Jf}?xr|Y.vLʇ! j[ԗ>\dz[=@=v(QlX~9$e$ ?ЫhcZI Lg.ɮ.KVaHq>`$n[zxi]BэT5nQ=wnVǝV?}Q+ϫ@H\#]DΛ}>I7G}K6:@n>/*J\a^?aiIcدJF@)ib>3oފ׭3jy%&f#LqG}>"$,M5'G=a5x 41,#ɭTq~8*:@]\{B:F ?o@5Yx<򙣂aΑ}$}=0Td}?cYC)x[S6%UsW:(Łaȷ{w6-ۥ2Hsz:JezXVN S}9п} >ЛDhAve1tX@lԸP,4%@)7ڥj>+nXHʚZ}>Pk]EzZ]o=O(ABԑfUQ@ bAz6t}Ե['VU,>=N.Oߏyh~{ja0`c]%ߴ;lTURBeѫJ>.?ַ.FzݨYO j6UDmhVo,l8m }#sM3@N9>vU21b {E:zˉCǥ"bl-׻^]C! 7~rQ 4aY`4_'/kD06 Bx.SL:J]I߀>ֺos{D\pHZW={퇿[xa{l?׽Kbt8蘀@4/7:P߃}7${6j[ӌQƐc|,jNQ{Vb8bE,T֧1Ms HEn>ⷤ9עZ"vf7_@}W~ u\~H>{^:Fk!$JڢT(-b->7.H BQ#gwcϖa䒆du6`R#"ZH_hJIE(mfCj_?O>y9J:&~϶)ps̓$TunWbdE ={07Ѻ$uyQ;Qs>-kRoD*8tOUMy^X.87"i,?:OǏJ%UP&߂i׺{rx?u:RxuSAPX_@m׭u@ ߿u^U^~ZGVVe5SNQU.OA>Y%(_hţn@6~}8JӥZi'Sm ZݾO|J;ߪzl'=8C*,Ll+skN#w1YEQ[rnoHUP7$dDM@յžX%l~nt~׺{^{{u׺{^*6˧b8%*5m./&zMn{xhKM 6xH{oz )Y&{Waƛq^.GH%Na Ӊhs`o7ӡ}`}s!+ܘJ?/?}?Pu12CȪGo6Gu:ucj2Tj PmpB[TЎ6}mjRK4rna!@2{mP=uV1KJ e1Ԥ-36pϸDcVC!BQ ʇ2LO$~i$GGoSɑ&{?}HiU5KIQR&*5 l>{IR{?ZuR#c%#{tz>NREL8 Y6vN}u߾ʼn?^׬߾A$S@SuՀo~W~&xzQҖ4+'}FATH+'ٞWjǍbX&9I7P~$:M\~=*6*:J{],(r$^zr1E5jING?dOt#)ZtPiv.vLT0<i^6K G}C~${53 +1fuM"o . hTKU/##ݺY\Ǻ`ì2:D jo%m*^DZ~}۹cLnKX_r& ?ibۖˣ bХSϠc;+dGfpm϶&%ؽϨEf:rϫ Qŏ4DB]#vM~{߽u}܏~"{@<O}{X_[~~XZqةTӦ|ފ], RjU"o}o3Ygp ^Ӛ>D?r4(>[S%PGy$i\18=e2h XEa%yly>ߨLקªuw!AOЊg6$Ho4tP?_|eFmR'OۙZ rpzc{Ӧ:P$+Аz ;Pwn\)'=[u!ҘV /͇2"r?N=|Sʤm~:p~{߽u~׽ߺ^~{߽u~׽js^YdjkE}W7/icn=փhڇ]W@%uYn~}2^?ǿծR5LnVO\x73*Iדnn:ZRZ>J~$4_Ҋ|Quu_&t^F$>yp -q~枊$-SO1~>O|zzY? Hu߿{^ 1??ouV?~ֺa?X?ԟuoc ǟrXJ l=Je|: 56j7P Oq o݁!x3G9K$l:T/o~׽E;~LׯuyޡsͅOic&bqA)#Ea!&= i2Es9l$uըbŽϬF[[=X}~EVnͳlQD$i1?_i_ٲtvȨi%4P}(~nԿ}f)6<^=]cwQ^Ud(#nO ).|O UJSUv ԺʄV6-W<8v^:b}=%4,Į7[~z׺{^{{u׺{^{{{{u׺{^{{u׺{^{{u׺{5{߽u~׽ߺ^~{߽變A?r)XO,o=rZ?>*VfZJEY=ErO<~O#?R?OկZ: =@C5\!yRI#7OͿ{@ENq,-Tb:hFf骱OX;ӥZ{>:ZwI z{HDI bu^_+qW.X'?}t L 4='ץKnL6笩k#e/ b[!X lEzq7I#@vS1Y<ΧQQJX8( Ѿռr&z{] mRUA"]ɍ-pY";zyƁO{R-t~,&7!,I +$y ھ:0^1KTl3)4C dV7}k$QPiET_¨sc{\~7<N} uo|o~nlx4dq=c՞R”q̃So7{Uou}&Fc$~H=j;vL;Zͻz6_Ԭ$rE}GG,rR TyvڻXuBiU4Gjrlƒ+Br׈xӠzl发';G$殃 :3v5KL߭.:gxo@Ǯ%E)4(젨U*9R ?tѮLvPUDD^H& moDz&9ui{o-JӪu~o:oiON$m ?i o"FuCp'~زhh_Ѡ[o6H]#}^ߟ#ވt@?PxurA@Tʜt&Nk'P:A[} >+]=__E}Ԩ+iL-Sq~O? 55Aqc=}k~_~{/~{߽u~׽cިk^EAV&y7zu^ 7_o~$pbGX&}2[K@\}囋j~JO]G゜'\{f-m<ƽZ딳SGFHce&ӋF:S[5I aFNm|ֱbA<C$i !q^?>7B$t^7N^ 4Spk(ڀus װۖl(}$7VH:ZtGu ZխRݜǨ\S-OPˤqnP*W'z`[sc+tO lMQyPJ9 ,OF)QYU2i d/1MWm*Ͼ($$A{|~]1Mr$m̴!lo?N?`mO:0iΡJ?}cij#ӥQqkCӎ=R'Ho|98tZzxci,??SǼH%x!RO\N.DlxnW!Y/nZۤEԋۏjDxakVIaQ7..c,i^읟;7bz|2;N}-,3k8$Qu̦ܽCkjJOxUPж_= ɿ=zRQ'4QVXquStA,I!⍲ jRH~@B [~2`a7lMpSS+ ~O!:> k8BO7&VMNLcOz#Vzs4@W Nh$1/n}Qdd$41,mƟUpMn.8L/ "5Ī`ʨYPolڤcn &}^&}r=M1Q= OI$HQٚxsNlAa4r[,M2:,ӟHr26}}yVӡmf?ʡ ,l-8#ݺg茶V]joR[PږxLJ@ ooayLT},n@ uP%:}G3XLu [H)̶2tT?!Z"길"M&EGCOB |lMjxXͅOe='QQf?[)ޤFѐ԰<wgmmH$kjHƦ[sqdmH}/•$uU{YXHG_/}4TېIâۡ7*z1Tݳ;"K*5N9e7Ԩc#qi zm7x>R zޮlG?DzүwB ܔµ'i ei +5loZgW =Gn/o@Y/' p 6H`]QBTSQPXθ$G ~(C?_IBƷ;1*E6^욬m)HҬXyt5F|O{dk*34H![?6>U)q6^kV#f* 돢!f3X nX Oi3}G?b`()^]X\)[J6*<ɯthUa:O=9cC;M" 5P$@I 8'쮞Rta3tнŜs`*eicF?P}}؍@{5\ĎkCIO{߆G7?>p:Vl YjU*C> pa_mq?>>*LzG-|LiqrߎOKuN PY"o"&nE#~}< to,z ?v4o$pk(!t昨[ng1 8z'Tu`D7?OۜP+|S$- (Dð{9ؙ25*,tV5}l{cIy=,N:t.ΨM1,Qlܓak?fTOAJ.G4irIQkyX8-rE؏UITnU&$.on]f <|Ɗ-ښjT܎yqԇKuP zRr,AYQ$BXaoM~YU^+ǩfBq""ʌ˻SuIs?/qnmxhICҾIi 8WUՉS㪅 #-: ۩puyEE D2܆&{U1 "jn%\ôwꍜrЦK-&'"&70z=ԆƝ.}Q8ZQL&p au5_d2^ybnOn-(\+6_9HHyڀ:j__qRSO>IQOaǻjU% O;zDk] O"~O ܃az(^gZUULq[=,}׎}´=>#0eUȉ J6$ x+N-{xupUrz푊&YWS e-gg}w#~??_n䕞M~} 85=hI#e!REϹqd76K{O%Ry '~=m=W&JX)XDyydߞy?g1E:vv7KWآr}E[=[{$l.A?>Sxҟ34*/.y#1mG$ 4*F+^R*H|oT&"U|Em,/+yb09V!A`װܩ䩩I7{0X_>~1X]&ͪERU)W,tG瑩&@O,'^}ٚB0@/qҳtS(G:no`Q!4z']drQENiK*WH, S5iZA 6皸’ڙepMߩ?OtQ׫XXͩnšTOnJ#y`Z.&{&Ц;I!~,m"Gd3UCAu[V(>O:hz.ꪔWxdmXќn]΢ [ߔӒ&:ajB Y۟jQ"[5$㎝#--`_Ou;qk ZR8T>F@Q?G)oixuk%̄cעۿPVN aNIh? "$FAfN]ɩ5PIRG0@j9&iPPtO2o.0{R YSW]ULP-&Yy9VI6 PC\#c1#͞KI!BIQ~o=d)<׽A^ʏ.1OQCLK:kqNY5ϽT-Թ=%'RZyp-Ȑۥ'ߟmB 6+,D'cßr;-ECe7O'msFanA6#i,]oo ٞME'ucw:TCr?{i[ *Poݾ}}zK/:_VU3Fvb-yp:=Y4M"L3YH"ֿȿuZx"{bG?O-ƛ~ oW=:_M:nJ5vsn<;n rm"]OYKvA;2C:eY0'IY2K7n Xd㪣Q@2$s.]=cti\>N8JM,@$*#1q>۳7ӻI1aGZl ㎚FGQ¸qoZH'?ǛZMGA45O'P[ro\ ?QR$inXG{ _=3lR>@)j~Yk=͹exnWyd~OZw2Ȍ}Wѭ5Sa&l!9m1f֧þ:-}8F"-EzdfREe{ D[M݇&kø*ߕGgGW zċFE18k_~CZ:24 dR'ª-Is zN sGO(~=ǠL dۏRtXAFA@N{n}u}^#G[^@&}OQ!߈Ў#+=;5`MyZ5<?yީN{ 8" WK/6_ڒTJ4F!xie;349j)~{`G9r:FmKz\?)GtSEW U!)^/oP kףHt"OA^XWWMQRRuq&ߟ|*_X9'ߔSMI#:1wTI5g}}*E:, ^9"Iq"42 /z%PTFzIfr4b6 ~L }>HR-Bߋ֡Nzܘ,r`W=O>sCm]_MKgG}7n=PM:JǁAV`ѸEIseA{9Ѝ4$\g\V\}DN 3`~[2Qsڊm9!8V jVv0.T܀.I${)QEek;ڒJy)qM؛{mu)[Y!U:I3&o<}gNҥ1(Mߏݏܴt@{`ƬFP2A^cql$*~ Նn- w^&;yT9}fyNyU_ſ Ӻ˩3BTz ēQE3T!H}DۄˑC{>ζ t kՕE.199(& 5qHP-D&Gtפ[Vȗw9޿&*zv5uqΑҲ+xq1e[m6ڴKqmM 4mС%*B$Y#6=ϊhqie4lSz/ۻj)w X+5XF-Mnm$o6H+\yB硿Pc1g&D|ڎAQ_PsY{t %6D)J~AwW((s4_bu}/{}}éEbtmuo p6:1IAQKTƖwr طܪ~M?=GF[:_C~9 jWPĎ<{Z i65N+ўֵ8 =7|`M .y2RPN<ߟbq`{)s7E.BX^ϼfn~$IT] o,}6Z67a8rUrڮfKdz%PAƸ^[b[ӦU[iԈQ.@n}ͦ%N-mo.,ػ,be)3j}JEǟlpzW}`Y5H=rUIAc#I m]ornÑNYJ7F>4 REqqmoͽˡ`?OкRRոtw.56yg >kkF@ן[2^Nm "8i[_5~s;G5XwSf 0: KH} 9E@Xp==ߤ*O /to٦kLf/tq+a[|kxI'8_ϴjt`:}*ˣDzV+4=epXmHsʰ=mۣ/+DPYQOH8?ؚ Q=F[.:O6.? #xR6,I'_X{Q_C7?~{.E͹ߏ׏) {Ӌ'?ҍ@r+5z[I"[ v =PƽH9qamDp\+Q@Uo\s~bkztMz20%ȵF {IL_څ]NgmDSn6$T0d4/X:OҌ޽~~^״ȱ?6y=oSMMNN[ _m֜:uNf45U8rOmov4EN4e O{H yb+մƮUBI?Cr?{H?יʖSD# Z<[z%;Ⱥ9mJ$Tu7ycgVg+>E6x>Ձu*G}=@PF#f /d($_WSar/EB:H.q}:\ߺ^~{V'{s]@quZ!yqAGǭZ:*dux-?Ao>FBE~'N: XiNrFֹ/}$9g_ X)\1]8F]'?|?[{#˦X7=HAO*6E矧{Uo q^ǟ${4=X)<QޮMf>#+{HgxMRfza]21QIe]~ܣ[1Mo~F-]^ 3UM; عFZ.c},?Sv?>ߨ:-1\HuMz/qiҮTFHi}2TOWThOHu6[VU=1# EH'Fz,R! 6Bd,piѴ 8`ZF I,~YSl<i}B#AnfeHiAb@po<=؊+(ee?E}mot-)NG<[k{ } tOhR4ߏ[~׺׺-krHWuLH<Ɋނ5T?@6mZM[+J[߁Pdt`#+KKZ8kiW~G}8tQ4ÂG=rJ,qy?ӟx=q3Cx J#,H_@[szy߿u׺ 5*mMJ#Ut JV sg:D1Ҡ&B8u{̶ =YܷQc#:$׽ߺ^~{߽u|TO>Mz1 G I.xSϼm9ymZ:SdL3O $B*!G6'*q'{~ok ^4^E6 9Ϣ~CfmUl 9&E;EA˨kGPX]Bz |&So1OGr.~Ԟ?Hzc]4.I6ӟ{<:0zF7#֪6}eV"5cytqoކpz;16: htY_S{=Cb?ۛUԅJHyX߯[zk eHb9ALF4IE'\2K{ibԁnt&6Adtу#U G^ֺ׺{^{{O?~t@<}ϺG[Ps)bW`O6{fWЅ:2ۭYA=+0XznʢHGn -a?L^ZI,~T=?2?o7*rm'jAqc=O=zZt͌˩:fڝ\M>4e$Oۣ]Oߏra }ƧHi(>Pf|ldMcV[HoZ#OuW*_5N{jX-{?˕oO=*jmo: $W(X*%hbiu0އ&`x9Db'%\^fJ)]ѬO>={[֯&HG @>?y >{>MM%7nk_P{Ԉm)|IGt;6,fRaGTk/wzB"W dh@coIR-qO2QJƆíۓH suRen=O}a{4x{٬xu&YIRu!H_ͮ=ΎUYǺˣXgYLټNK`q>`++Tj/K}SS=5PQU$>/Jy% *kbe-1ц2r1lN`x8`H -q"i]o?6D80*: 7bn*/8&[[&`5{M~:׫ZF֡s-?ϿP=hc7Qk^߁eJz*&5"?M}x<؞-qC֨x{䀘?}]d68աcqߟF0BnZYBqS,NhK,M?^ip.Atq)ЁBS*#-nV?>8uNMNێool2;F662]J0: +dbЮ@-~mvOsN(,,p1G SS;QjjQ!X*nls*I$yGWЋjFN|y\vR(>z-@iE:y{SFz*yTSZt7|ۙ\]FnJXzRFr?؇{9Ր{ި:^{{߽u}O_މVU,hadO*DNl?諂nָoZm u Si)X 'q>:$u=7Zdtiڰe%jdqn=Eƶ"R.8Jta  udIM#DͤHl{Qxt]vd&mj"?pXi>nMϼp<\ߋf&J}MRy?׏r"B{qaDҨ%(9!w1mqkǟ׿,+_Q(G^Xڡ:(I(`iD`+yo*?\^tDvUCRSId, ^}2$jaD`ukyIY=FG چG'=>﫦q .n}SC^#ȽÑqq"rÏtB07Iʺ'-tD4^P.Iܶ]܁"æz3}<jr&cR\p=萊t`7 W?_}oɷ~]rsG[iƌ[{^=+ɽ㧌@-OI s}=J$ sa{{$u_*RoǠ0<iџEk X*W֜5fCV${GEXZ,:܏7@A{W׽ߺ^5ہsƝ; ,Ffl}SB@[{xAȽtZ]Rkn|ႋ R)̠L@Vu{YCܖWh^m(RI/>PF%؀E?mHd:WA ϝ^\=<=kY $ܕ=έ#K~@ˢ61M)UU:`~XS^-׏@\ՄN*)!B 'P[_{ ^'݅:qZ=kZmAy}I+ה`ϬU3%<TI`F16/?yfPX_#H3WtZigI>uAb6ځ#-+6m[\矯R^1t3ץ-xՌu)vU3Sj4,-drD0܎A,[XD}WUvɔcDI4ޙJ.pB.xc >*/ˑ HPIp}&>=NOAֿ+& #ءxQ4(y*K E/n{0K==f1!L]W[j+jcY-W}O^,yR~q P~y ;1&إ{e|ۧ%I{x" uƠ?tnGțPj1p@W$5S  eF%\{g@,5_پ3HOA=<}sqǏ3CLͩc9"k,/Ҵ\yu`5JrjŇ7{noÏv"+[{)ca]Y龶„ZZЎoIߩָ0>3R$/`9#IKR>;Ksٌ!^VТU{VuNB,{X)vgX Y٬ נRҰ'Sl>2*eHd5{>诡[ߏǯurbƴb?H.@Ui_isHnI}\.Hn!R*$X/c'c#M*P[~?~q~}Y<$/Ɲ?ah.Nݕr5^gY2 p9..и&_/[dAz]rxz'{x/Xs8 y}hY -&ā?Of4ATzb`jOČ,?H)%iJ8쉧^i-=)6AH䓠m_Oxߤ)ak_z=YNӨqyg2F?#}c [`9`zWsr/jZl4Վ*j7"=♆>/ܔ_. nGZ1K]PǑrnooQolSL]19=+, *`_O6'}lqcz8A [M"n9_uિE_ &8H?=Ѱj:[ Bi^Y\~fkl8?>մ} e?bV*L"DQ 4OOg~}؎@/ܨ&T\{u@==|˩$_׏nѲ eF-ТhZCyiIO!&kzmszQH}ܯ#ѱꍍ&9rt qB{wtVϯCUd~V˦[?ou^=9q rܠ $Mo:m=@t>m9J8VgU4NT?rM_skm ס)Jh)O.?O"r:ƪ0s!p ŏq˘p7].kҫvT;{j6S:-'LQko!f}) ˤdk!sR\Z;`ߏh@zipއWS-QM4, },!a??'X?: .<<: i]ݘei#S&}@%̍K{2f$I`kP7ٔ 6&ƽ"k*ys^J)H\j$H<\ޔi4Eߏ)cofdAdfq&z.Nqo|㲰*:v 'L؞Z ŇBocqkA iiЩ[=GӢSGع 'd(S+NPam{]JʕM'4}Je㒯QI<[OH#x4m Eib5[mM3+IbVڭ 1YArF.h|MbRҝ,{'z\]nhIsr>3rm{g'w5p\.TS ~$O7aoX$l|^#׬CCth֑\=!&ن: x3IW H9߶c PːH"9$J( Gz4&]@*zdtWcFF n,>@ k[f99O1ѥhUA\J'/}*/e?>btעHQd }C SQ{aik~$,Z`ӪOs\6JVRti= >{k;h`?Ïf{ljo>\;|6z5c&13ڕ"Z{^S[ImpjȞ :.M1T.f,}LK8Xce~jz hm=uYIAkQ{[۽ >ݍJ)ǡ#9 G qOD/rOiTy4>6z`M3k!T/p=*5``nU4R;cʓk})e/7fq>? }XM! VgI?DId[ԱGwXiH"y*`/oWKomN= -692$2yRl-jJ7[~}xVhi(#=*񽅷k#SOG,3ȈJ*6Ycuh#I+uK)SU i aѬP6_NPUb.TW3'teqty+0^PH_{<5=7:xL@<z0&plI*dhQM:{~t Rװ;31aXXϗU]+n|Eڛ 2nnUM7?>vq-H89b6ZPˣmg,8)%Deh,-cg?.~:t РTGyH,ǥ1[,V95T>((K}>@#+C8y=NIN=U,sM,q~bs1CO H"x'cru'un ?UŘݥoQ$sTϩ͇P(R8@Ño$2= _PWG tߖxp'I=Jur+F zј3[fQob ,^n40 [~A=k]RtRCvYJylB ݹe}~{Tnsҍ!`1äHn{]z< IF~GوRYL^kl_~*oxתd#d)+] ΈI KYH>t-˥\BYz+# ̨MǾ#RBI.Su*"x&aTF8ՑSoiY p~㳵"H}z :{pqy 餉iB]X&$Cythz5(d+0@nH#?=2AA-KSumeZգR5.>܉!-c!`~]w*kSn9+5MG\bVK}Kίf8'2ҕ`뢍R_Yix[*t*x}V]Z5pzŽUm2$fPxߥXVmZM[r=A$wR1_C{m#J괺?Y򦬪od{q-킔2\AےW@t:žiegH}.l߁E+ĐYZ?O7>I^ws56%TӪg~~և'[IS2:uep|ޫ&s?=SS=[u%4T$h(bK {OM1GYrkΑ.O :X.D4g $ކTz:I${l@#{2L[7"ӡ7=QuztMs'wL[-Ib"?]؟k_>U%_ mM5YW%H }}ǨDe!_~oM[tJcСԻqT'y/vl΁Mmz0E5bFQ6qo}V `AOjʺ:wQ;RCpЬ]Ora#ODǥV0HE@̈k܎'{e&Vsm姇핾` ΰ$2-v<A~O"U*9G#4~s͍I' }yR?}îBQڋh8#'EI68g轕IڴUcE0&^M{I_O?R}iDh[!s(ç~/ j-OUP7T+`9AEzmЦ: X@=b?SX[ pGV)Sad='w% YOztڪ [?9=HJz%_As7˪bݛ+uOUKzdVby؄utJѡ1<:jg D4Ll,WOP@G(diiaKܚZ,ߨHk{bn+bmQZw7NbIKg!9+"~G@85UE׺qq#ߺ\Y-so}8s{?B>n}Յz^VR%Zyoy#EcrmԜt(Q4+RS@HPUtܔcb.HӏueԴ=.!zyt횬<1ͨș>??>m G[t㢪Q]eC<`G]B4y]F>cE^wJjiٛ/*xfT9Ea>[BG_}d\4}tHPK>;4~y*=5d34O-Lj"ENAEJ_MiT?7C-lH3|^K=: e$m6_}"po!/_SSץ$MH}NZ 2NoQ{pP蜊Jrd"㖈26:܁= 2MtɳR?5ڝ/&X%hdu#3Ocz0GmţW:0i_2<'}]1wį⥤ loD=DY2swl{8{Z]YIQ+)T^0y(&H~OAN(/'1½s('sOo,TQaQ$o{'/CaR+t|o4W&D[[m2d8*>ң#Zt+WI2syRp~}ȎiuHry'Kr<-4KDۉVn=>%4yV1 J-n?QR=7<+â`DkpBR|IkeqLSȪ 1#Yp 97$}OfàɯG2D8" ԔPOtkӏ?cDcL:NZc.&U7hu^G*~}"SqYЂ%j[rL)Tr i~}3xxT^yt3RC %U]~m?{T;py? -:]U pJU c\G|k'HGGR'q(kjIG HmB_GeBzlW4\ HJ0ɯOb#,X<}Z/&.-uWD,T0'oϼ&Лt#==?.23]Dv^nGp>MҊmA ~6XϿtN~NWMc̵"Es}9}^~{^P f&$_>]j+^nHM)^ߐj񔢇dȀC:KI[sl1on?>7 ?z6)] ϠB >bGK2\X&@ߴi6{Y]J~cǵV֫oR'}y;"?5W5r/,tl=RW6?qs}DRGF.JUCQJ4Wicc{ooTUjzU-"sZtl\F/URLĄ]-bI{a-^=#po6{`OЎ?oz_>^tGRgv{ݺN~{{H4xɥzOl`SV?)sH:J@1Gp$mFX/ܲL=-mpOCc1kM02Sx O5@^=>[G}w}pB ??]Z-M)ռ~NY{K^vƶ;AY>q>%"ژ/H/@)^>ح0bڵV#Āj-$Fl?/@*zKrBzX0M=\-}>Aژ’J3+{zr>L 6Qjo!ra-4I5ژ-cqYar4}o{u_XFC/mG61S$ }=7t[q =&~RJcP pJZX5ſ{QF\ raPOFDW'\SF]*뤚$1-K.[=ǎEGor/Zt" ۛf{nįG`/mV {- ג Vk {3q՘~JPЬbK'[#ۑ?RC҃niDF)SH# o~[uX*}8gtMR@i1j8|{G4l~}=,L3vYjFG9PkmFrQ.@ۓ=)vgiڸ:-=m{f Yya[sO>GJסOYG^#3U+}!I6'Wm %0*| {jrV]bZ}?_mnIQ)fsV5$qF?{|kb?CskWn)ik/rt+8Y.Rkⴜy2gtY7B ?OU`ĴTH$4][Zßy**K)A϶s^^K鏏H)3mFj4T ==CN]nOWẄhƟV:4lXE!o]*Bo[VI;ۄ6憵eۦS|^OKCUK+]}I>u6Qr_ yެ!ƟϢwgܻpKNE=<^K/ɵo@Q9sp4QG"ԍ?_}UW^O~:q@#[VI" צ\wkG Xېnntܓ"βHz>Wt[(ywf邋|Tx6?lF[{T}GD ӣ1SB+,lDir߀V1?_#3k-'#K $Z}Ͼ^ ?6mVfbٴks|!<~@R# PHϾ^׺׺{^{.?߽u}-_z&lxu?*߿=)ǮH{{Pu0 7}Ia^UCtxQelIa^jWD‰Ry\=߽u~íSNN!#J1$}EیP>{a) j =;v$95E'D7_pFǛO˘<&= _6jXo}#Gat9LUd e?? ?/ƢdE#ڀ4!@[#߀gM)>3o6>MKHۛo|=nx` LƒOj"h#>%=d *&_VZtJvtfH*Xn?ɪOOȞ=dtS34y$v`r, h$sU5ܮiIqdA[U$us:$ߟ}LBjz-vBRl̮/oH)#5p\C>4n~{G2ۓ½,0!P8F=WDm6%vgKrHdj|X$ P {ߺo~׽qH8蚺n=qêCN'$AXANHOpQ4M\-w]ٖ֡ 66<(}yމmgKdfbdXjmf76Tc}%x_vaHvJ:罦p4UWxIUR.ޟ {qvBpÏ[ H$Ba4==ݴ%E=Lfu0:l\ZlRX#N^GL|A#Ag}^{{{{q2ۏ=iNv'Zl.Cwf-%SʥVQpڕm[} qE735(z;[$&2o} k)Q>V=? ʆC3䠠+IQ(@,?ԛ}oۣ# 4_NZYE<3q,j0~u׺{^SI$[SH"Mg˥}&ݹ&zH2]%\{U@ c{_%m<:4v?C~LRuFuXd_QCp:I߅L(}ܟdFy\81es`=7& "j]V:y[YW亡o_{kuSϠQOSlJX媦lӮQm7M{X:"|2h3"S܈t?t#[jɑ󊶏r~J MWǗҽ8|%QH&}2xHsǭKz3k>l}fQê(.z6eu@bܖ @\?~*MsۦdQQN^I렆АUf$( ' ot]KR+( "}y}=u:0&)?^4>jOvӤF?F`-nǸ>r=ʝ$'G$`z_O }<~0 oohF::^ xL7w]Bi֥dWl{hGb4ϣᒛA ęcQ}Ks{u݉Mҽ:yD-Ͼ8> zY\}=6{[iMsJ-T}9*LO{<ַqQTPVQX&LtVVR߈G׺6?'{JX#Kyma:L-MDHjBXԞ9?OUeTڢkZtcw7CzGM9H+Ds&c: [{iHnM=:Q咃$cK3IV?3-P/c:1Қ +qv!r"7$iQ^GFXoTPRSК^EVPIFkx?{Sk 'C#qIu1F$ [!_#ׇIzXp q}^ĈC[?" Zb=OK̝|*i!u_Ǹڮon._vj=. d,#`>'IA kd$RpajlD;|76x*,2,U-[m?$[$׀ucNd)*l}O^z?^AG]\es_. S޽;EKVi~ꊄ(%[:L _mo"#7mmѫV':Q\N)1 V1